Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14942

Ccdc114 coiled-coil domain containing 114 ( MGI:2446120)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942
"Pseudo-wholemount" of euxassay_008023. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008023_01 euxassay_008023_02 euxassay_008023_03 euxassay_008023_04
EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942
euxassay_008023_05 euxassay_008023_06 euxassay_008023_07 euxassay_008023_08 euxassay_008023_09
EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942
euxassay_008023_10 euxassay_008023_11 euxassay_008023_12 euxassay_008023_13 euxassay_008023_14
EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942
euxassay_008023_15 euxassay_008023_16 euxassay_008023_17 euxassay_008023_18 euxassay_008023_19
EMAGE:14942 EMAGE:14942 EMAGE:14942 EMAGE:14942
euxassay_008023_20 euxassay_008023_21 euxassay_008023_22 euxassay_008023_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14942Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14942_wholemount_strong.wlz
14942_wholemount_moderate.wlz
14942_wholemount_weak.wlz
14942_wholemount_possible.wlz
14942_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14942_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 08 09
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 12 14 15 16 17 moderate expression: see section 13
4th ventricle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 08
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 04 05 08 weak expression: see section 03 09
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 weak expression: see section 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 18 19 20 weak expression: see section 13 14 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36012
Entity Detected:Ccdc114, coiled-coil domain containing 114 ( MGI:2446120)
Sequence:sense strand is shown

>T36012
CCGATCTCATCATGTACCAGAAGATGAAAATCCAGAGAAGGATCAGGATCCTTGAAGACCAGCTGGACAG
GGTCACCTGTCATTTTGACATCCATCTGGTGAGGAATGCAGCCCTGCGGGAGGAGCTGGAGCTGCTGCGC
ATCGAGAGGGGCCGCTACCTGAATATGGACCGCAAGCTGAAGAAGGAGATCCACCTACTCCGGGAGATGG
TTGGAGCTCTCAGCACATCCTCTACTTCTGCTTATACTGCCAGGGAAGAGGCCAAGACCAAGATGGGCAT
GCTTCAGGAGCGCGCAGAGAAGGAGCTGGCTCAGAGTGATACGGAGGCACAGATCTTGCTGCGACAGATA
TCGCATCTGGAGCAGCTGCATCGATTCCTTAAGCTCAAGAACGATGAACGACAACCGGATCCCCGTGTGG
TGCAAAAGGCAGAACAGCGAGACTGGGAAGTGTCAGAAGGACTCCGAAAGACCTCCCAAGAGAAGCTAGT
GCTGCGTTATGAGGACACTCTGGGCAAACTGGCCCAGCTGACCGGCGAGAGCGACCCTGACCTTTTGGTG
GAGAAATACCTGGAGTTGGAGGAACGCAACTTTGCTGAGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80428. Forward Primer - name:080428_F_cDNA_BC013491, sequence:CCGATCTCATCATGTACCAGAA; Reverse Primer - name:080428_N_SP6_cDNA_BC013491, sequence:AAACTCAGCAAAGTTGCGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14945 same embryo
 EMAGE:14943 same embryo
 EMAGE:14944 same embryo
 EMAGE:14941 same embryo
 EMAGE:14940 same embryo
 EurExpress:euxassay_008023 same experiment
 MGI:4823666 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS