Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14977

Lrrc16b leucine rich repeat containing 16B ( MGI:2448573)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977
"Pseudo-wholemount" of euxassay_008003. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008003_01 euxassay_008003_02 euxassay_008003_03 euxassay_008003_04
EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977
euxassay_008003_05 euxassay_008003_06 euxassay_008003_07 euxassay_008003_08 euxassay_008003_09
EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977
euxassay_008003_10 euxassay_008003_11 euxassay_008003_12 euxassay_008003_13 euxassay_008003_14
EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977
euxassay_008003_15 euxassay_008003_16 euxassay_008003_17 euxassay_008003_18 euxassay_008003_19
EMAGE:14977 EMAGE:14977 EMAGE:14977 EMAGE:14977
euxassay_008003_20 euxassay_008003_21 euxassay_008003_22 euxassay_008003_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14977Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14977_wholemount_strong.wlz
14977_wholemount_moderate.wlz
14977_wholemount_weak.wlz
14977_wholemount_possible.wlz
14977_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14977_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 06 07
metencephalon rest of alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 03 04
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18 19
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 weak expression: see section 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 16 17 18
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 12 13 14 15 17 18 19 20
extraembryonic component
moderate moderate
regionalmoderate expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36025
Entity Detected:Lrrc16b, leucine rich repeat containing 16B ( MGI:2448573)
Sequence:sense strand is shown

>T36025
CTCGGAAACTTCCACATCTACCACTCACAGTGTGTGTGGTGGCTTCTCTGAGACCTACGCTGCCCTGTGT
GACTACAATGGACTCCACTGCCGAGAGGAGGTGCAATGGGATGTGGACACCATCTACCATGCTGAGGATA
ACCGAGAGTTCAATCTTTTGGATTTCAGCCACTTGGAGAGCCGAGATCTGGCCCTCATGGTGGCCGCCCT
GGCCTACAACCAGTGGTTCACCAAACTCTACTGCAAAGACTTGAGACTGGGCTCAGAAGTGCTAGAACAG
GTGCTACATACCCTCAGCAAGTCGGGGAGCCTCGAAGAGCTGGTGCTGGACAATGCTGGGCTTAAGACGG
ACTTTGTCCAGAAGCTGGCCGGGGTGTTTGGGGAGAACGGGAGCTGTGTGCTGCATGCGCTCATTCTGTC
CCACAACCCCATCGAGGACAAGGGTTTCCTCAGCCTGAGCCAGCAGCTCCTCTGCTTCCCTACGGGCCTC
ACCAAACTGTGCCTGGCCAAGACTGCCATCTCTCCTCGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84686. Forward Primer - name:084686_F_cDNA_BC036313, sequence:CTCGGAAACTTCCACATCTACC; Reverse Primer - name:084686_N_SP6_cDNA_BC036313, sequence:CTCGAGGAGAGATGGCAGTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14972 same embryo
 EMAGE:14975 same embryo
 EMAGE:14973 same embryo
 EMAGE:14976 same embryo
 EMAGE:14974 same embryo
 EurExpress:euxassay_008003 same experiment
 MGI:4825990 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS