Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15254

Eno2 enolase 2, gamma neuronal ( MGI:95394)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254
"Pseudo-wholemount" of euxassay_010442. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010442_01 euxassay_010442_02 euxassay_010442_03 euxassay_010442_04
EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254
euxassay_010442_05 euxassay_010442_06 euxassay_010442_07 euxassay_010442_08 euxassay_010442_09
EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254
euxassay_010442_10 euxassay_010442_11 euxassay_010442_12 euxassay_010442_13 euxassay_010442_14
EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254
euxassay_010442_15 euxassay_010442_16 euxassay_010442_17 euxassay_010442_18 euxassay_010442_19
EMAGE:15254 EMAGE:15254 EMAGE:15254 EMAGE:15254
euxassay_010442_20 euxassay_010442_21 euxassay_010442_22 euxassay_010442_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15254Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15254_wholemount_strong.wlz
15254_wholemount_moderate.wlz
15254_wholemount_weak.wlz
15254_wholemount_possible.wlz
15254_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15254_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 10 13 14 15 weak expression: see section 09
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15 weak expression: see section 07 08 09 10 11
pons mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 16 weak expression: see section 07 08 09 10 11 17
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 18 19 20
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 07 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 12 13 14 15
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30204
Entity Detected:Eno2, enolase 2, gamma neuronal ( MGI:95394)
Sequence:sense strand is shown

>T30204
GGCCCTGGAACTAAGGGATGGGGACAAACAGCGTTACTTAGGCAAAGGTGTCCTGAAGGCAGTGGACCAC
ATCAACAGCAGGATTGCACCAGCCCTCATCAGCTCAGGTATCTCCGTGGTGGAGCAGGAGAAACTGGACA
ACCTGATGTTGGAACTGGATGGGACTGAGAATAAATCCAAGTTTGGGGCCAATGCCATCCTGGGTGTGTC
CCTGGCCGTGTGTAAGGCTGGGGCAGCTGAGAGGGACTTGCCCCTCTATCGCCACATTGCTCAGCTAGCT
GGGAACTCCGACCTCATCCTGCCTGTGCCGGCCTTTAATGTGATCAATGGTGGCTCTCATGCTGGGAACA
AGTTGGCCATGCAGGAGTTCATGATCCTCCCAGTGGGTGCTGAGAGCTTTCGGGATGCCATGCGACTTGG
GGCAGAGGTGTACCACACCCTCAAGGGGGTCATCAAGGACAAGTATGGCAAGGATGCCACTAACGTGGGG
GATGAAGGCGGCTTTGCCCCCAATATCCTGGAGAACAGCGAAGCCTTGGAGCTGGTGAAGGAAGCCATCG
ACAAGGCTGGCTACACGGAAAAGATGGTGATCGGTATGGATGTGGCTGCCTCTGAGTTTTACCGCGATGG
CAAATACGACTTGGATTTCAAGTCTCCCGCTGATCCTTCCCGATACATCACTGGGGACCAGCTGGGGGCA
CTCTACCAGGACTTTGTCCGGAACTATCCTGTGGTCTCCATTGAAGACCCATTTGACCAGGACGACTGGG
CAGCTTGGTCCAAGTTCACAGCCAACGTCGGCATCCAGATAGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4527274), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9319. Forward Primer - name:009319_F_IRAV51-54_E14_Eno2, sequence:GGCCCTGGAACTAAGGGA; Reverse Primer - name:009319_R_SP6_IRAV51-54_E14_Eno2, sequence:CCCACTATCTGGATGCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15257 same embryo
 EMAGE:15256 same embryo
 EMAGE:15253 same embryo
 EMAGE:15255 same embryo
 EMAGE:15252 same embryo
 EurExpress:euxassay_010442 same experiment
 MGI:4824552 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS