Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15360

Lrfn5 leucine rich repeat and fibronectin type III domain containing 5 ( MGI:2144814)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360
"Pseudo-wholemount" of euxassay_010530. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010530_01 euxassay_010530_02 euxassay_010530_03 euxassay_010530_04
EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360
euxassay_010530_05 euxassay_010530_06 euxassay_010530_07 euxassay_010530_08 euxassay_010530_09
EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360
euxassay_010530_10 euxassay_010530_11 euxassay_010530_12 euxassay_010530_13 euxassay_010530_14
EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360 EMAGE:15360
euxassay_010530_15 euxassay_010530_16 euxassay_010530_17 euxassay_010530_18 euxassay_010530_19
EMAGE:15360 EMAGE:15360 EMAGE:15360
euxassay_010530_20 euxassay_010530_21 euxassay_010530_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15360Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15360_wholemount_strong.wlz
15360_wholemount_moderate.wlz
15360_wholemount_weak.wlz
15360_wholemount_possible.wlz
15360_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15360_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 15 16
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30569
Entity Detected:Lrfn5, leucine rich repeat and fibronectin type III domain containing 5 ( MGI:2144814)
Sequence:sense strand is shown

>T30569
AAGCTGCCTCCTGACCCTCTGTTTCAGCGAGCACAGGTGCTGGCCACCTCAGGAATCATAAGCCCATCGA
CTTTTGCATTGAGTTTTGGTGGAAACCCCTTGCATTGCAATTGTGAGTTGCTGTGGCTGAGGCGATTGTC
TCGAGAAGATGACCTTGAGACGTGTGCTTCTCCTGCACTTTTAACTGGTCGTTATTTTTGGTCAATTCCT
GAGGAAGAGTTTTTGTGTGAGCCTCCGCTCATCACTCGTCATACACATGAGATGAGAGTCTTGGAGGGTC
AAAGGGCAACACTGAGGTGCAAAGCTCGAGGAGACCCTGAACCTGCGATTCATTGGATTTCCCCTGAAGG
GAAGCTGATTTCAAATGCAACACGATCTCTGGTGTATGATAACGGGACACTTGACATCCTTATAACAACT
GTAAAAGATACAGGAGCTTTTACCTGTATTGCTTCCAATCCGGCAGGGGAAGCAACACAAACCGTGGATC
TTCACATAATTAAACTCCCTCACCTACTAAACAGCACCAATCATATCCATGAGCCTGATCCTGGTTCTTC
TGATATCTCCACATCCACTAAGTCAGGCTCGAATGCTAGCAGTAGTAATGGTGATACAAAAATGAGTCAA
GATAAAATCGTGGTGGCAGAAGCAACTTCGTCAACAGCATTACTAAAATTTAATTTTCAAAGAAATATTC
CCGGAATCCGTATGTTTCAAATCCAGTACAATGGTACTTATGATGACACCCTTGTTTACAGAATGATACC
TCCTACGAGCAAAACATTTCTGGTCAATAATCTGGCATCTGGAACTATGTATGACTTGTGTGTCTTGGCC
ATCTATGACGATGGCATCACTTCCCTCACTGCCACAAGAGTCGTGGGTTGCATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5708346), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59081. Forward Primer - name:059081_F_IRAV112_e03_Lrfn5, sequence:AAGCTGCCTCCTGACCCT; Reverse Primer - name:059081_R_SP6_IRAV112_e03_Lrfn5, sequence:GGATGCAACCCACGACTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15355 same embryo
 EMAGE:15358 same embryo
 EMAGE:15357 same embryo
 EMAGE:15356 same embryo
 EMAGE:15359 same embryo
 EurExpress:euxassay_010530 same experiment
 MGI:4825976 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS