Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15491

H2afv H2A histone family, member V ( MGI:1924855)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491
"Pseudo-wholemount" of euxassay_010704. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010704_01 euxassay_010704_02 euxassay_010704_03 euxassay_010704_04
EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491
euxassay_010704_05 euxassay_010704_06 euxassay_010704_07 euxassay_010704_08 euxassay_010704_09
EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491
euxassay_010704_10 euxassay_010704_11 euxassay_010704_12 euxassay_010704_13 euxassay_010704_14
EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491
euxassay_010704_15 euxassay_010704_16 euxassay_010704_17 euxassay_010704_18 euxassay_010704_19
EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491 EMAGE:15491
euxassay_010704_20 euxassay_010704_21 euxassay_010704_22 euxassay_010704_23 euxassay_010704_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15491Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15491_wholemount_strong.wlz
15491_wholemount_moderate.wlz
15491_wholemount_weak.wlz
15491_wholemount_possible.wlz
15491_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15491_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19
pons ventricular layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 15 weak expression: see section 13 14
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38111
Entity Detected:H2afv, H2A histone family, member V ( MGI:1924855)
Sequence:sense strand is shown

>T38111
GTAACAGGGCAGAGGGGACTAGTGCGGTGTGCGGAAGAGCATAGACGGTTGCTGTAGACGAGACAAAGGC
CACATCTGTATGTTTTTAGACTCGGAGTTTGATGAGTCCCTTTCCCTGTGGTCACAGTCATGTGTTGATT
GGCCAGGTTTCTCCCTTGTGTTTTATACAAAAGTAGAATTGATAAAACATTTTTTACAAAAGTACTGTGT
CTCAGTATTTCTTCATGATGTATTAGAAATACTTTTTTCAAACCTGGCCAGGGCCATGTTGCCTGCATCC
CCAGCGTTTGGGAGGTGTGGGCAGGACCTTCAGAATACAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 109787. Forward Primer - name:109787_F_cDNA_H2afv, sequence:GTAACAGGGCAGAGGGGACTA; Reverse Primer - name:109787_N_SP6_cDNA_H2afv, sequence:GTGTATTCTGAAGGTCCTGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15488 same embryo
 EMAGE:15490 same embryo
 EMAGE:15492 same embryo
 EMAGE:15493 same embryo
 EMAGE:15489 same embryo
 EurExpress:euxassay_010704 same experiment
 MGI:4825303 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS