Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15519

Ppp1r14a protein phosphatase 1, regulatory (inhibitor) subunit 14A ( MGI:1931139)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519
"Pseudo-wholemount" of euxassay_010732. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010732_01 euxassay_010732_02 euxassay_010732_03 euxassay_010732_04
EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519
euxassay_010732_05 euxassay_010732_06 euxassay_010732_07 euxassay_010732_08 euxassay_010732_09
EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519
euxassay_010732_10 euxassay_010732_11 euxassay_010732_12 euxassay_010732_13 euxassay_010732_14
EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519 EMAGE:15519
euxassay_010732_15 euxassay_010732_16 euxassay_010732_17 euxassay_010732_18 euxassay_010732_19
EMAGE:15519 EMAGE:15519
euxassay_010732_20 euxassay_010732_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15519Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15519_wholemount_strong.wlz
15519_wholemount_moderate.wlz
15519_wholemount_weak.wlz
15519_wholemount_possible.wlz
15519_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15519_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
inner ear
moderate moderate
regionalmoderate expression: see section 06 18
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 21 weak expression: see section 02 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38316
Entity Detected:Ppp1r14a, protein phosphatase 1, regulatory (inhibitor) subunit 14A ( MGI:1931139)
Sequence:sense strand is shown

>T38316
GAGTCACGGTCAAGTACGACCGACGGGAGCTGCAGCGACGGCTGGACGTGGAGAAGTGGATCGACGGATG
CTTGGAGGAGCTGTACCGCGGCAGGGAGTCAGACATGCCGGACGAGGTCAACATCGATGAGCTATTGGAA
TTGGACAGTGAAGAGGAAAGATGCCGGAAAATCCAGGGACTTCTGGAGGCTTGTGCAAATCCCACAGAGG
ACTTCGTCCAGGAGCTACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 148348. Forward Primer - name:148348_F_cDNA_Ppp1r14a, sequence:GAGTCACGGTCAAGTACGACC; Reverse Primer - name:148348_N_SP6_cDNA_Ppp1r14a, sequence:CAGTAGCTCCTGGACGAAGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15522 same embryo
 EMAGE:15518 same embryo
 EMAGE:15521 same embryo
 EMAGE:15520 same embryo
 EurExpress:euxassay_010732 same experiment
 MGI:4827369 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS