Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15547

Nacad NAC alpha domain containing ( MGI:3603030)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547
"Pseudo-wholemount" of euxassay_010774. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010774_01 euxassay_010774_02 euxassay_010774_03 euxassay_010774_04
EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547
euxassay_010774_05 euxassay_010774_06 euxassay_010774_07 euxassay_010774_08 euxassay_010774_09
EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547
euxassay_010774_10 euxassay_010774_11 euxassay_010774_12 euxassay_010774_13 euxassay_010774_14
EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547 EMAGE:15547
euxassay_010774_15 euxassay_010774_16 euxassay_010774_17 euxassay_010774_18 euxassay_010774_19
EMAGE:15547 EMAGE:15547 EMAGE:15547
euxassay_010774_20 euxassay_010774_21 euxassay_010774_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15547Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15547_wholemount_strong.wlz
15547_wholemount_moderate.wlz
15547_wholemount_weak.wlz
15547_wholemount_possible.wlz
15547_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15547_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
cervical ganglion
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 07 08 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16
neural retina
strong strong
regionalstrong expression: see section 02 03 moderate expression: see section 01 04 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 weak expression: see section 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
tongue
moderate moderate
spottedmoderate expression: see section 09 11
stomach
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08
midgut
moderate moderate
spottedmoderate expression: see section 10 11 weak expression: see section 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38344
Entity Detected:Nacad, NAC alpha domain containing ( MGI:3603030)
Sequence:sense strand is shown

>T38344
ATGATGACAGGCTGTACAGTGGGGAGCCCCATGCCCAGCCCAGTGCTCAGAATACAGAGCAGGCCTACAG
AAGTAGGGCTACATTCCCAGGGATAGAGTCCACACCTCAGACATCAGAGCAAGAGATCTGTCTTACCAAT
AGCCAGGAATCAGTTGCAGAAATAGCAGAAGAGATCCTAACTCTAGGCCTAGAGTCTGAAGCTATGAGGA
CACCTCCTGATCAGCAAGCAGCTCCAGGCCCCCAGGTGGAGGAAACTCCCACAGTGACCCCTTGGGTGGG
GAACAAAGTTGACCTGGTTGTAGAACAAGTATCCAAGGCTCTTCCTGAGCCCTGCCAGGAGGGGATAAGC
ACCACCTTAGGCTGTAAGCCCCTCACTGCAGAGGCAATTCCAGATCTGCAGGAAGGAGCAAGCCCCAGCT
TGTGTCCAGTCCTTCCTGAGAAGAAGGAAGAAGGCCAGGGCCTTCCCTCGACACTGGAGTATGTGGCTGT
GGCTTTAGAGGGGCCCTGGAAGGCTGAGGGAGGTGTCACAATACCGCAGGACCCCCTTATGACATTGCCC
CCACTCTTGCAAAGTACAGTTCCCACCTCAGGCCCAGAGTCTGTGGCGGTAGTCGCACTAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 109792. Forward Primer - name:109792_F_cDNA_LOC192950, sequence:ATGATGACAGGCTGTACAGTGG; Reverse Primer - name:109792_N_SP6_cDNA_LOC192950, sequence:CTCTAGTGCGACTACCGCCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15549 same embryo
 EMAGE:15548 same embryo
 EMAGE:15551 same embryo
 EMAGE:15546 same embryo
 EMAGE:15550 same embryo
 EurExpress:euxassay_010774 same experiment
 MGI:4826584 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS