Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15601

Lipm lipase, family member M ( MGI:1926003)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601
"Pseudo-wholemount" of euxassay_010767. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010767_01 euxassay_010767_02 euxassay_010767_03 euxassay_010767_04
EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601
euxassay_010767_05 euxassay_010767_06 euxassay_010767_07 euxassay_010767_08 euxassay_010767_09
EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601
euxassay_010767_10 euxassay_010767_11 euxassay_010767_12 euxassay_010767_13 euxassay_010767_14
EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601
euxassay_010767_15 euxassay_010767_16 euxassay_010767_17 euxassay_010767_18 euxassay_010767_19
EMAGE:15601 EMAGE:15601 EMAGE:15601 EMAGE:15601
euxassay_010767_20 euxassay_010767_21 euxassay_010767_22 euxassay_010767_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15601Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15601_wholemount_strong.wlz
15601_wholemount_moderate.wlz
15601_wholemount_weak.wlz
15601_wholemount_possible.wlz
15601_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15601_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
anterior naris
moderate moderate
regionalmoderate expression: see section 14 15 17 18
external naris
moderate moderate
regionalmoderate expression: see section 14 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31239
Entity Detected:Lipm, lipase, family member M ( MGI:1926003)
Sequence:sense strand is shown

>T31239
TGTTTGCAGCCTACACCGTGTTCTTTCATTCCTGTTCTTCTTCTGACTCTAGATGTAGTTGTTACATCCT
TAGCAACAAAGCAAATGCCGATGTTGGACCATGTCAGAAATCTTGTCAAGAGTGTGGACTGTTTCGCACA
GAGTGGAGATATGGCTTCTGATTCTGGTAGCATATTTACTCCAAAGAAATGTGAACTCGGGACATTTGCC
CACGAAAGCTGCGGATCCAGAAGCATTCATGAATGTTAGCGAAATCATCAAACACAAGGGTTATCCCAGT
GAGGAGTATGAAGTTGCAACAGAAGATGGGTACATCCTTTCTGTGAACAGAATCCCTCGGGGACAGACAC
GGTTAAAGAAGGAAGGATCCAGGCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4020396), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55344. Forward Primer - name:055344_F_IRAV48_h12_Lipl3, sequence:TGTTTGCAGCCTACACCG; Reverse Primer - name:055344_R_SP6_IRAV48_h12_Lipl3, sequence:ACTGGCCTGGATCCTTCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15596 same embryo
 EMAGE:15600 same embryo
 EMAGE:15598 same embryo
 EMAGE:15599 same embryo
 EMAGE:15597 same embryo
 EurExpress:euxassay_010767 same experiment
 MGI:4825940 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS