Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15661

Slc10a4 solute carrier family 10 (sodium/bile acid cotransporter family), member 4 ( MGI:3606480)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661
"Pseudo-wholemount" of euxassay_010865. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010865_01 euxassay_010865_02 euxassay_010865_03 euxassay_010865_04
EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661
euxassay_010865_05 euxassay_010865_06 euxassay_010865_07 euxassay_010865_08 euxassay_010865_09
EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661
euxassay_010865_10 euxassay_010865_11 euxassay_010865_12 euxassay_010865_13 euxassay_010865_14
EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661 EMAGE:15661
euxassay_010865_15 euxassay_010865_16 euxassay_010865_17 euxassay_010865_18 euxassay_010865_19
EMAGE:15661 EMAGE:15661 EMAGE:15661
euxassay_010865_20 euxassay_010865_21 euxassay_010865_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15661Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15661_wholemount_strong.wlz
15661_wholemount_moderate.wlz
15661_wholemount_weak.wlz
15661_wholemount_possible.wlz
15661_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15661_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 10 11 12 13 14 15 16
telencephalon mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 18 19 20 21 22 moderate expression: see section 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 moderate expression: see section 05
pons mantle layer
strong strong
single cellstrong expression: see section 06 07 10 11 15 16 17 moderate expression: see section 05
midbrain mantle layer
strong strong
single cellstrong expression: see section 09 10 11 12 13 14
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 10 16
ventral grey horn
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
single cellmoderate expression: see section 12 weak expression: see section 06
cervical ganglion
weak weak
single cellweak expression: see section 05 06 14 15
thoracic ganglion
weak weak
single cellweak expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38333
Entity Detected:Slc10a4, solute carrier family 10 (sodium/bile acid cotransporter family), member 4 ( MGI:3606480)
Sequence:sense strand is shown

>T38333
CTGTACTCCTATGTGGCTGCTGTCCTGGTGGAAATCTCTCCAATCTCATGTCCCTGCTGGTAGACGGCGA
CATGAACCTCAGCATCATCATGACCATTTCCTCCACACTCCTGGCCCTGGTGTTGATGCCCCTCTGCCTC
TGGATCTACAGCCGTGCCTGGATCAATACCCCTCTGGTGCAATTGCTCCCCCTAGGGGCAGTCACCCTGA
CTCTCTGCAGCACTCTCATTCCTATTGGGCTAGGCGTCTTCATTCGCTACAAATACAACCGCGTGGCTGA
CTACATCGTGAAGGTTTCCCTGTGGTCTCTGCTTGTGACCCTGGTGGTTCTTTTCATAATGACTGGCACC
ATGCTGGGACCTGAACTGCTGGCAAGCATTCCCGCAACTGTTTACGTGGTCGCCATTTTTATGCCTCTGG
CGGGCTACGCCTCGGGTTATGGCTTAGCTACCCTCTTCCACCTCCCGCCCAACTGCAAGCGGACTGTGTG
TCTGGAAACAGGAAGTCAGAACGTGCAGCTCTGCACTGCGATTCTCAAACTGGCCTTCCCGCCTCGCTTT
ATAGGTAGCATGTACATGTTCCCTCTGCTCTACGCCCTCTTCCAGTCTGCCGAGGCAGGGGTCTTCGTGT
TGATCTACAAAATGTACGGAAGTGAGATACTGCACAAGCGAGAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105187. Forward Primer - name:105187_F_cDNA_E130304D01, sequence:CTGTACTCCTATGTGGCTGCTG; Reverse Primer - name:105187_N_SP6_cDNA_E130304D01, sequence:GCCTCTCGCTTGTGCAGTATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15658 same embryo
 EMAGE:15657 same embryo
 EMAGE:15660 same embryo
 EMAGE:15659 same embryo
 EMAGE:15656 same embryo
 EurExpress:euxassay_010865 same experiment
 MGI:4828092 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS