Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15695

Cacnb1 calcium channel, voltage-dependent, beta 1 subunit ( MGI:102522)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695
"Pseudo-wholemount" of euxassay_010905. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010905_01 euxassay_010905_02 euxassay_010905_03 euxassay_010905_04
EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695
euxassay_010905_05 euxassay_010905_06 euxassay_010905_07 euxassay_010905_08 euxassay_010905_09
EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695
euxassay_010905_10 euxassay_010905_11 euxassay_010905_12 euxassay_010905_13 euxassay_010905_14
EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695 EMAGE:15695
euxassay_010905_15 euxassay_010905_16 euxassay_010905_17 euxassay_010905_18 euxassay_010905_19
EMAGE:15695 EMAGE:15695
euxassay_010905_20 euxassay_010905_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15695Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15695_wholemount_strong.wlz
15695_wholemount_moderate.wlz
15695_wholemount_weak.wlz
15695_wholemount_possible.wlz
15695_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15695_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 19
upper leg muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 16 17 18
diaphragm
moderate moderate
regionalmoderate expression: see section 02 03 13 14 15 18 19 weak expression: see section 01 04 05 06 07 08 09 10 11 12 16 17 20 21
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 02 03 13 14 15 18 19 weak expression: see section 01 04 05 06 07 08 09 10 11 12 16 17 20 21
brain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 09 10 11 12 13 14 15 16 17 weak expression: see section 02 08 18 19 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 17 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 15 16
spinal cord
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 weak expression: see section 08
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 12 13
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 13 14 15 weak expression: see section 12
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38901
Entity Detected:Cacnb1, calcium channel, voltage-dependent, beta 1 subunit ( MGI:102522)
Sequence:sense strand is shown

>T38901
GGAGTACGTCCTCGGATACAACATCCAACAGCTTCGTCCGCCAGGGCTCAGCAGAGTCCTACACGAGCCG
ACCATCAGACTCTGATGTGTCTCTGGAGGAGGACCGCGAAGCCTTAAGGAAGGAGGCAGAGCGCCAGGCC
TTAGCCCAGCTCGAGAAAGCCAAGACCAAACCAGTGGCTTTTGCTGTTCGGACAAATGTTGGCTACAATC
CGTCTCCAGGGGATGAGGTGCCTGTACAGGGAGTGGCCATCACCTTTGAGCCCAAGGACTTCCTACACAT
CAAGGAGAAGTACAATAATGACTGGTGGATTGGGCGGCTGGTGAAGGAAGGCTGCGAGGTTGGCTTCATC
CCCAGCCCGGTCAAACTGGACAGCCTTCGTCTGCTGCAGGAACAGACCCTGCGCCAGAACCGCCTCAGCT
CCAGCAAGTCAGGTGACAACTCCAGTTCCAGTCTGGGAGATGTGGTGACTGGCACCCGCCGCCCCACACC
CCCTGCCAGTGGTAATGAAATGACTAACTTTGCCTTTGAGCTAGACCCCCTAGAGTTAGAGGAGGAGGAG
GCAGAGCTAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 270222. Forward Primer - name:270222_F_cDNA_Cacnb1, sequence:GGAGTACGTCCTCGGATACAAC; Reverse Primer - name:270222_N_SP6_cDNA_Cacnb1, sequence:CTAGCTCTGCCTCCTCCTCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15692 same embryo
 EMAGE:15693 same embryo
 EMAGE:15694 same embryo
 EMAGE:15697 same embryo
 EMAGE:15696 same embryo
 EMAGE:15698 same embryo
 EurExpress:euxassay_010905 same experiment
 MGI:4823581 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS