Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15769

Myf5 myogenic factor 5 ( MGI:97252)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769
"Pseudo-wholemount" of euxassay_013164. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013164_01 euxassay_013164_02 euxassay_013164_03 euxassay_013164_04
EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769
euxassay_013164_05 euxassay_013164_06 euxassay_013164_07 euxassay_013164_08 euxassay_013164_09
EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769
euxassay_013164_10 euxassay_013164_11 euxassay_013164_12 euxassay_013164_13 euxassay_013164_14
EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769
euxassay_013164_15 euxassay_013164_16 euxassay_013164_17 euxassay_013164_18 euxassay_013164_19
EMAGE:15769 EMAGE:15769 EMAGE:15769 EMAGE:15769
euxassay_013164_20 euxassay_013164_21 euxassay_013164_22 euxassay_013164_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15769Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15769_wholemount_strong.wlz
15769_wholemount_moderate.wlz
15769_wholemount_weak.wlz
15769_wholemount_possible.wlz
15769_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15769_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
regionalweak expression: see section 01 02 03 05 06 19 20 21 22 23
upper leg muscle
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
diaphragm
weak weak
regionalweak expression: see section 17 18 19
forearm rest of mesenchyme
weak weak
regionalweak expression: see section 01 02 03 19 20
hand
weak weak
regionalweak expression: see section 19 20
foot
weak weak
regionalweak expression: see section 19
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 20 21 22 23
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 weak expression: see section 02 03 04 22 23
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 weak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39038
Entity Detected:Myf5, myogenic factor 5 ( MGI:97252)
Sequence:sense strand is shown

>T39038
CATGTGCTGCAGATAAAAGCTCCGTGTCCAGCTTGGATTGCTTGTCCAGCATTGTGGATCGGATCACGTC
TACAGAGCCATCCGAGCTGGCTCTTCAGGACACAGCTTCCCTCTCTCCAGCGACCAGCGCCAACTCACAG
CCTGCTACCCCGGGACCCTCCAGCTCCAGACTTATCTATCACGTATTATGAACTCTCTCCCGATGATCAC
TCCTGCTAGGAGGGCGTCCTTCATGGAGGAAAAGAAGCCCTGAAGCTGAAGGAAAGACAAGCTGGGCAGA
ATACGTGCTTTTCGGTTGTAAATACTGTCTTGCCACTTTATGAGAAAATAGATTTAACTGAAAGTCACAT
TTGCAATAATGGATTCTCCTCTGCCTGTTCTTTTTGCTTTCGGTTTTTTTTTTTTTTTTTTTTTAGCTTC
CAATTGCTTTAGATACATGATTCCAGAAATATTTTTCTGTTGGAGGCAATTAATTGACAGTTACTTAGAG
TAATTCTTAACTTATACATATATATTGTAAATATTGCACATCAAAATAACTTTGGTATTTAGAGCTCTAT
ATTTTTCTTCAAAATAACATTTTAACAGCTTGGAATCCATTACAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 236009. Forward Primer - name:236009_F_cDNA_Myf5, sequence:CATGTGCTGCAGATAAAAGCTC; Reverse Primer - name:236009_N_SP6_cDNA_Myf5, sequence:CCCTGTAATGGATTCCAAGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15772 same embryo
 EMAGE:15770 same embryo
 EMAGE:15768 same embryo
 EMAGE:15771 same embryo
 EMAGE:15767 same embryo
 EurExpress:euxassay_013164 same experiment
 MGI:4826538 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS