Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15782

Fam161a family with sequence similarity 161, member A ( MGI:1921123)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782
"Pseudo-wholemount" of euxassay_013156. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013156_01 euxassay_013156_02 euxassay_013156_03 euxassay_013156_04
EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782
euxassay_013156_05 euxassay_013156_06 euxassay_013156_07 euxassay_013156_08 euxassay_013156_09
EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782
euxassay_013156_10 euxassay_013156_11 euxassay_013156_12 euxassay_013156_13 euxassay_013156_14
EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782 EMAGE:15782
euxassay_013156_15 euxassay_013156_16 euxassay_013156_17 euxassay_013156_18 euxassay_013156_19
EMAGE:15782 EMAGE:15782 EMAGE:15782
euxassay_013156_20 euxassay_013156_21 euxassay_013156_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15782Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15782_wholemount_strong.wlz
15782_wholemount_moderate.wlz
15782_wholemount_weak.wlz
15782_wholemount_possible.wlz
15782_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15782_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 02
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 14
choroid invagination
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38889
Entity Detected:Fam161a, family with sequence similarity 161, member A ( MGI:1921123)
Sequence:sense strand is shown

>T38889
TGTCCACAACTACTGATGAGGGGTTGCCCGACCTAGAGGAAAAGACTCCCGGGGAAAGCAGCGCAATGGT
CCATGCCCAGGAGCTCATAAACAACATGTGGAACGACTTTTCTGTTGAAGATTATATTCAGTATGACTCA
GACTCCCGAACAGCTAAGAAAAAAAGGAAGAAAGCTAAATCCTTGACACCCAAGATTACAGTGCCTGTAC
CCTTTGAAATGACGGTAAGAGAGCAGAATCGGAGAGAGAAGGCCTTGAGTGCTCGGTCAGATCTGGAAAC
AAAGCTGCTCAAGAGGGACGAGGACGATGCAGAGTGTAAGAAGAAATTCCGAGCCAATCCCGTTCCTTCC
TGCGTGCTCCTTCCCCTTTATGAGGATCTAGTCAAGCAGAGTGAGGAGCGCCGGAAGAAGGCCCGGGAGA
GGAACAGAGCTGCGCTCCTGGCCTCCCTGAAGCCCTTTAAGTTCATTGCGAGGGAGGAACAGAAGCAAGC
AGTCCGCGAGAAGAAGCTGAGAGACCTTTTTAGGGCTAAAAGGAAAACGAATCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 177851. Forward Primer - name:177851_F_cDNA_4930430E16Rik, sequence:TGTCCACAACTACTGATGAGGG; Reverse Primer - name:177851_N_SP6_cDNA_4930430E16Rik, sequence:CTGATTCGTTTTCCTTTTAGCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15781 same embryo
 EMAGE:15780 same embryo
 EMAGE:15779 same embryo
 EMAGE:15784 same embryo
 EMAGE:15783 same embryo
 EurExpress:euxassay_013156 same experiment
 MGI:4824715 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS