Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15903

Gm5654 predicted gene 5654 ( MGI:3645051)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903
euxassay_013337_01 euxassay_013337_02 euxassay_013337_03 euxassay_013337_04 euxassay_013337_05
EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903
euxassay_013337_06 euxassay_013337_07 euxassay_013337_08 euxassay_013337_09 euxassay_013337_10
EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903
euxassay_013337_11 euxassay_013337_12 euxassay_013337_13 euxassay_013337_14 euxassay_013337_15
EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903 EMAGE:15903
euxassay_013337_16 euxassay_013337_17 euxassay_013337_18 euxassay_013337_19 euxassay_013337_20
EMAGE:15903 EMAGE:15903 EMAGE:15903
euxassay_013337_21 euxassay_013337_22 euxassay_013337_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15903Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15903_wholemount_strong.wlz
15903_wholemount_moderate.wlz
15903_wholemount_weak.wlz
15903_wholemount_possible.wlz
15903_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15903_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
strong strong
ubiquitousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40079
Entity Detected:Gm5654, predicted gene 5654 ( MGI:3645051)
Sequence:sense strand is shown

>T40079
CTCTGATCCAGGAAAGAAGGAGGCTCAGATGACCGGTGTGGAAGGCCAGGGGCAATACTGGGCCAGTGAG
ATTCATGTGGTGATGTTTGCTCTTCGGCAGCAGTTTACGGGCACACTGAAGAAGATGAAGTCATCCGGGG
AGATTGTGTACTGCGGGCAGGTGTTTGAGAAGTCACCCCTGCTCGTGGAAGAGATTGCATCTGGCAAATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 151756. Forward Primer - name:151756_F_cDNA_LOC435309, sequence:CTCTGATCCAGGAAAGAAGGAG; Reverse Primer - name:151756_N_SP6_cDNA_LOC435309, sequence:CATTTGCCAGATGCAATCTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15902 same embryo
 EMAGE:15901 same embryo
 EMAGE:15905 same embryo
 EMAGE:15906 same embryo
 EMAGE:15904 same embryo
 EurExpress:euxassay_013337 same experiment
 MGI:4825112 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS