Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15919

Camsap2 calmodulin regulated spectrin-associated protein family, member 2 ( MGI:1922434)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919
"Pseudo-wholemount" of euxassay_013367. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013367_01 euxassay_013367_02 euxassay_013367_03 euxassay_013367_04
EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919
euxassay_013367_05 euxassay_013367_06 euxassay_013367_07 euxassay_013367_08 euxassay_013367_09
EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919
euxassay_013367_10 euxassay_013367_11 euxassay_013367_12 euxassay_013367_13 euxassay_013367_14
EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919 EMAGE:15919
euxassay_013367_15 euxassay_013367_16 euxassay_013367_17 euxassay_013367_18 euxassay_013367_19
EMAGE:15919 EMAGE:15919 EMAGE:15919
euxassay_013367_20 euxassay_013367_21 euxassay_013367_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15919Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15919_wholemount_strong.wlz
15919_wholemount_moderate.wlz
15919_wholemount_weak.wlz
15919_wholemount_possible.wlz
15919_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15919_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 01
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 16 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 14 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 03 05 06 07 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 15
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 10 12 13 14
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22
mandible
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20
maxilla
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 16 17 18 19
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39975
Entity Detected:Camsap2, calmodulin regulated spectrin-associated protein family, member 2 ( MGI:1922434)
Sequence:sense strand is shown

>T39975
GTGACTAAACGGAGACAAAGGGGAGGCGGAGGGGCAGACCCGGGCCGGAGCGAGCGCGGCCGGGTGCCGC
CTCACGTCTATGCCCGGGGCCGCGGCGGCTCCCGCGGGCGGCGGACTCGCGACGAGCACAGCTGAGCTTT
TCCGTGCCCGGCGCCCGGGAGGGCCGCGACCGGCGCGGACGATCTGAACTCCTCTCTCCGCCACACCATG
TGAAGGCCGTCGTCCCTCCATCCCAACCAGCCGCCGTGAAAGATGGGGGATGCTGCAGACCCGCGGGAGA
TGAGAAGGACGTTCATTGTTCCAGCCATCAAACCCTTTGACCACTATGACTTCTCCAGGGCCAAAATCGC
CTGCAATCTGGCCTGGCTGGTGGCCAAAGCCTTTGGGACAGAAAATGTGCCCGAGGAGCTTGGCGACCCA
TTTTACACAGACCAGTATGACCAGGAGCACATCAAACCCCCTGTCGTTAACCTGCTTCTGTCGGCCGAGC
TGTACTGTCGCGCTGGAAGCCTCATCCTCAAGAGCGATGCTGCAAAGCCCCTCCTGGGCCATGATGCTGT
GATCCAGGCATTAGCACAGAAAGGCCTGTATGTCACTGACCAGGAGAAACTGGTAACTGAAAGAGATCTC
CACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 108082. Forward Primer - name:108082_F_cDNA_LOC433353, sequence:GTGACTAAACGGAGACAAAGGG; Reverse Primer - name:108082_N_SP6_cDNA_LOC433353, sequence:TGTGGAGATCTCTTTCAGTTACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15921 same embryo
 EMAGE:15920 same embryo
 EMAGE:15922 same embryo
 EMAGE:15923 same embryo
 EMAGE:15918 same embryo
 EurExpress:euxassay_013367 same experiment
 MGI:4823609 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS