Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16071

Bmp2 bone morphogenetic protein 2 ( MGI:88177)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071
"Pseudo-wholemount" of euxassay_013498. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013498_01 euxassay_013498_02 euxassay_013498_03 euxassay_013498_04
EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071
euxassay_013498_05 euxassay_013498_06 euxassay_013498_07 euxassay_013498_08 euxassay_013498_09
EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071
euxassay_013498_10 euxassay_013498_11 euxassay_013498_12 euxassay_013498_13 euxassay_013498_14
EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071
euxassay_013498_15 euxassay_013498_16 euxassay_013498_17 euxassay_013498_18 euxassay_013498_19
EMAGE:16071 EMAGE:16071 EMAGE:16071 EMAGE:16071
euxassay_013498_20 euxassay_013498_21 euxassay_013498_22 euxassay_013498_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16071Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16071_wholemount_strong.wlz
16071_wholemount_moderate.wlz
16071_wholemount_weak.wlz
16071_wholemount_possible.wlz
16071_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16071_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 19 weak expression: see section 05 20 21
metanephros
moderate moderate
regionalmoderate expression: see section 06 17 weak expression: see section 07 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45046
Entity Detected:Bmp2, bone morphogenetic protein 2 ( MGI:88177)
Sequence:sense strand is shown

>T45046
GATCTTCCGGGAACAGATACAGGAAGCTTTGGGAAACAGTAGTTTCCAGCACCGAATTAATATTTATGAA
ATTATAAAGCCTGCAGCAGCCAACTTGAAATTTCCTGTGACCAGACTATTGGACACCAGGTTAGTGAATC
AGAACACAAGTCAGTGGGAGAGCTTCGACGTCACCCCAGCTGTGATGCGGTGGACCACACAGGGACACAC
CAACCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 226074. Forward Primer - name:226074_F_exon_Bmp2, sequence:GATCTTCCGGGAACAGATACAG; Reverse Primer - name:226074_N_SP6_exon_Bmp2, sequence:ATGGTTGGTGTGTCCCTGTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16069 same embryo
 EMAGE:16067 same embryo
 EMAGE:16068 same embryo
 EMAGE:16070 same embryo
 EMAGE:16072 same embryo
 EurExpress:euxassay_013498 same experiment
 MGI:4823483 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS