Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16079

Fam46c family with sequence similarity 46, member C ( MGI:1921895)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079
"Pseudo-wholemount" of euxassay_013491. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013491_01 euxassay_013491_02 euxassay_013491_03 euxassay_013491_04
EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079
euxassay_013491_05 euxassay_013491_06 euxassay_013491_07 euxassay_013491_08 euxassay_013491_09
EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079
euxassay_013491_10 euxassay_013491_11 euxassay_013491_12 euxassay_013491_13 euxassay_013491_14
EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079
euxassay_013491_15 euxassay_013491_16 euxassay_013491_17 euxassay_013491_18 euxassay_013491_19
EMAGE:16079 EMAGE:16079 EMAGE:16079 EMAGE:16079
euxassay_013491_20 euxassay_013491_21 euxassay_013491_22 euxassay_013491_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16079Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16079_wholemount_strong.wlz
16079_wholemount_moderate.wlz
16079_wholemount_weak.wlz
16079_wholemount_possible.wlz
16079_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16079_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pancreas
weak weak
regionalweak expression: see section 08 09 10
lens
weak weak
regionalweak expression: see section 01 02 03
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45611
Entity Detected:Fam46c, family with sequence similarity 46, member C ( MGI:1921895)
Sequence:sense strand is shown

>T45611
CTGTTACTACCAGCCAGCTCCTTACGTCAGTGATGGCAACTTCAACAACTATTACATTGCGCACCCTCCA
ATTACCTACAGCCAGCCTTATCCTACATGGCTGCCCTGTAACTAACCTGAAGACCTGAGGGTTTCCACAG
TGGGAACTCGGTTAGGGCAGGGGCTCTCAGGTAGGAGAGCCTCTTTCTAGATGTAGGTGTTTGGCTTTCG
AAGGGGAACTCAGCTCCGACTCTGTTTTTCTTTTTGTACCCATTGGAATAGGTCCACAGACTATCGTGAG
CCAACCCTAAAAGGACCCATAGTTGAGTGCCACTCAGGGAGATGCAATAGGAGGCGTGACTTCTCACCAT
CTTTCTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 199932. Forward Primer - name:199932_F_exon_4930431B09Rik, sequence:CTGTTACTACCAGCCAGCTCCT; Reverse Primer - name:199932_N_SP6_exon_4930431B09Rik, sequence:TAGAAAGATGGTGAGAAGTCACG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16081 same embryo
 EMAGE:16084 same embryo
 EMAGE:16083 same embryo
 EMAGE:16082 same embryo
 EMAGE:16080 same embryo
 EurExpress:euxassay_013491 same experiment
 MGI:4824744 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS