Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16087

C230004F18Rik RIKEN cDNA C230004F18 gene ( MGI:3041217)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087
"Pseudo-wholemount" of euxassay_013522. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013522_01 euxassay_013522_02 euxassay_013522_03 euxassay_013522_04
EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087
euxassay_013522_05 euxassay_013522_06 euxassay_013522_07 euxassay_013522_08 euxassay_013522_09
EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087
euxassay_013522_10 euxassay_013522_11 euxassay_013522_12 euxassay_013522_13 euxassay_013522_14
EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087 EMAGE:16087
euxassay_013522_15 euxassay_013522_16 euxassay_013522_17 euxassay_013522_18 euxassay_013522_19
EMAGE:16087 EMAGE:16087 EMAGE:16087
euxassay_013522_20 euxassay_013522_21 euxassay_013522_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16087Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16087_wholemount_strong.wlz
16087_wholemount_moderate.wlz
16087_wholemount_weak.wlz
16087_wholemount_possible.wlz
16087_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16087_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45423
Entity Detected:C230004F18Rik, RIKEN cDNA C230004F18 gene ( MGI:3041217)
Sequence:sense strand is shown

>T45423
AAACAACATCCCTCACCCATAGTTGAAACTTTGGCTTCAGACCCTTCTCTGGCACTTCTGACAATAAGTT
TGGTGACCCATGCTCTGGAGGAAGAAAGTGAAGAAGAGCAAGACTACTTCTCTGCAGCAAACTCTGATGT
TCTCTGTTCTTTCCTTACCACTGTTGTCATGAGCAGCATTTTTTCCCATAGGTGCATTGTTATCCTTGCC
ATGAGAGCAGACAAAAATGAAAAATAGTTGCCAAGTAACCAGAACTGCTGATAAGAAACTTTGGGAAATA
CCACTGAGATGTGCTTTGGTATTTTATTTCTGGGAACAAACCAATTGTCTTGGACTTTCACAGTACTCTT
TTCTATGTCTCACCCTTTACCACAAAGGTCCTTAAGTCCTTTGACATGCATAGTGTGAGGGATTCTGGCA
CACATTCTAGAACCTCGCAAAGTGGGGGGGGGGGGCTGCTATCTGCTTTATCATCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 189389. Forward Primer - name:189389_F_exon_C230004F18Rik, sequence:AAACAACATCCCTCACCCATAG; Reverse Primer - name:189389_N_SP6_exon_C230004F18Rik, sequence:AGATGATAAAGCAGATAGCAGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16090 same embryo
 EMAGE:16089 same embryo
 EMAGE:16085 same embryo
 EMAGE:16088 same embryo
 EMAGE:16086 same embryo
 EurExpress:euxassay_013522 same experiment
 MGI:4823546 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS