Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16619

Pnma3 paraneoplastic antigen MA3 ( MGI:2180565)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619
"Pseudo-wholemount" of euxassay_016813. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016813_01 euxassay_016813_02 euxassay_016813_03 euxassay_016813_04
EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619
euxassay_016813_05 euxassay_016813_06 euxassay_016813_07 euxassay_016813_08 euxassay_016813_09
EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619
euxassay_016813_10 euxassay_016813_11 euxassay_016813_12 euxassay_016813_13 euxassay_016813_14
EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619
euxassay_016813_15 euxassay_016813_16 euxassay_016813_17 euxassay_016813_18 euxassay_016813_19
EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619 EMAGE:16619
euxassay_016813_20 euxassay_016813_21 euxassay_016813_22 euxassay_016813_23 euxassay_016813_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16619Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16619_wholemount_strong.wlz
16619_wholemount_moderate.wlz
16619_wholemount_weak.wlz
16619_wholemount_possible.wlz
16619_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16619_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63136
Entity Detected:Pnma3, paraneoplastic antigen MA3 ( MGI:2180565)
Sequence:sense strand is shown

>T63136
GACTACCTACCTGGTCAGCCACTTCTACACCCTGGCACGTGTTGTGAGCTTCTGTGCCAGCCTAGGCTAT
GCTAGCTGCTCTCTTACCCACCTGGTGTTGTGAACTCCTTGTCAGCTTTCCTAGTGTACATCTAGGCCAG
CTGCCTGCTGCTTGTTCTCTTGCAGATGTGTGTGTGTGCGCGTGTGTTCTAACCTGATCAGATGCTCCCC
GGAGTTCCTGAGCTCCGTCTGGAAGCCAGCAGGAACCATGGATGTTGACAAGAGACTGGCTGATGCTCAT
CTTACGATTGATTTCAGTCTGGGACAGGAAGACCTGAACTGGGCATGGGTAGGGCCTGGGGACTGGGCTG
TGCTGATCCCCTCCTGTTGTTCCTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 178566. Forward Primer - name:178566_F_cDNA_Pnma3, sequence:GACTACCTACCTGGTCAGCCAC; Reverse Primer - name:178566_N_SP6_cDNA_Pnma3, sequence:CAAGGAACAACAGGAGGGGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16616 same embryo
 EMAGE:16617 same embryo
 EMAGE:16615 same embryo
 EMAGE:16620 same embryo
 EMAGE:16614 same embryo
 EMAGE:16618 same embryo
 EurExpress:euxassay_016813 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS