Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16831

Parm1 prostate androgen-regulated mucin-like protein 1 ( MGI:2443349)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831
"Pseudo-wholemount" of euxassay_008620. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008620_01 euxassay_008620_02 euxassay_008620_03 euxassay_008620_04
EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831
euxassay_008620_05 euxassay_008620_06 euxassay_008620_07 euxassay_008620_08 euxassay_008620_09
EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831
euxassay_008620_10 euxassay_008620_11 euxassay_008620_12 euxassay_008620_13 euxassay_008620_14
EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831 EMAGE:16831
euxassay_008620_15 euxassay_008620_16 euxassay_008620_17 euxassay_008620_18 euxassay_008620_19
EMAGE:16831 EMAGE:16831
euxassay_008620_20 euxassay_008620_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16831Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16831_wholemount_strong.wlz
16831_wholemount_moderate.wlz
16831_wholemount_weak.wlz
16831_wholemount_possible.wlz
16831_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16831_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 19 20 21
upper leg muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 17 18 19 20 21
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 21
hand
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21
foot
strong strong
regionalstrong expression: see section 06 07 08 09 10 19 20 21
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 20 21
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pancreas
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
hindbrain meninges
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 08 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 09 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 18 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 17 18 19 20
spinal cord mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
spinal cord meninges
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 19 20 21
naris
strong strong
regionalstrong expression: see section 11 14
anterior naris
strong strong
regionalstrong expression: see section 12 13 15 16
external naris
strong strong
regionalstrong expression: see section 12 13 15 16
posterior naris
strong strong
regionalstrong expression: see section 12 13 15
nasal cavity
strong strong
regionalstrong expression: see section 11 12 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 13
aorta
strong strong
regionalstrong expression: see section 12 13 14
heart valve
strong strong
regionalstrong expression: see section 12 13 14
esophagus
strong strong
regionalstrong expression: see section 13 14
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
rectum
strong strong
regionalstrong expression: see section 13 14
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 18 19
bladder
strong strong
regionalstrong expression: see section 11 12 13 14
kidney calyx
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18 19
kidney pelvis
strong strong
regionalstrong expression: see section 10 11 17
ureter
strong strong
regionalstrong expression: see section 15
interstitium of the testis
strong strong
regionalstrong expression: see section 07 08 18 19
left lung
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1240
Entity Detected:Parm1, prostate androgen-regulated mucin-like protein 1 ( MGI:2443349)
Sequence:sense strand is shown

>T1240
TCCTCGAGNCTGTTGGCCTACTGGACTTCGCCTTGCGCCGCCAGACACCGAAGCTGCCTGGACTCGTCGC
GCCTGGCGTCCCCGCTCCTCCCGTAGCCCACCCGGTCCGAAGAGGAGCTGCCGGTGCCCCGAAGCACTTG
GTCAGACCCAGGAAACTCTTCTCTAGTCGCATCCAGCTCGGTACCGAGCACCAGAGTAATATGGTCTGCA
AGGTGCTCATCGCCCTCTGCATCTTCACCGCAGGACTGAGGGTACGGGGTTCACCAACAGTCCCATTGCC
TGTCTCTCTCATGACAAAAAGTTCAGCACCTGTGGCCACCTGGACTACCTCTGCTCCACACACTGCTAGG
GCCACCACCCCTGTAGCCAGTGCCACTCACAACGCCTCAGTTCTCCGCACCACTGCCGCATCCCTGACAT
CTCAGCTCCCCACTGACCACAGAGAAGAAGCTGTCACCAGCCCACCTTTGAAGAGGGATGTCAACAGCAC
AGACTCCTCACCTGCCGGGTTCCCCTCAACAAGCAGTGATGGCCACTTGGCACCCACACCTGAGGAACAC
AGTCTTGGAAG
Notes:The probe template was PCR amplified from IMAGE:2192863 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2192863 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16833 same embryo
 EMAGE:16832 same embryo
 EMAGE:16830 same embryo
 EMAGE:16828 same embryo
 EMAGE:16829 same embryo
 EurExpress:euxassay_008620 same experiment
 MGI:4827052 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS