Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17009

Slc12a2 solute carrier family 12, member 2 ( MGI:101924)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009
"Pseudo-wholemount" of euxassay_008837. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008837_01 euxassay_008837_02 euxassay_008837_03 euxassay_008837_04
EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009
euxassay_008837_05 euxassay_008837_06 euxassay_008837_07 euxassay_008837_08 euxassay_008837_09
EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009
euxassay_008837_10 euxassay_008837_11 euxassay_008837_12 euxassay_008837_13 euxassay_008837_14
EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009
euxassay_008837_15 euxassay_008837_16 euxassay_008837_17 euxassay_008837_18 euxassay_008837_19
EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009 EMAGE:17009
euxassay_008837_20 euxassay_008837_21 euxassay_008837_22 euxassay_008837_23 euxassay_008837_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17009Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17009_wholemount_strong.wlz
17009_wholemount_moderate.wlz
17009_wholemount_weak.wlz
17009_wholemount_possible.wlz
17009_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17009_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 17 18 19
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 03 04 05 21 22 23 moderate expression: see section 02
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 weak expression: see section 03 04
rectum
moderate moderate
regionalmoderate expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 14 15
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 13 14
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 15 16 17 18 19 20
left lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
right lung
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2947
Entity Detected:Slc12a2, solute carrier family 12, member 2 ( MGI:101924)
Sequence:sense strand is shown

>T2947
GGCCTCGANGCCAGATTCGGCACGAGGTTTTTTTTTTTTTTTTGATGACTCCACTTCCTTTATTGCAGTA
ACTTCTGTACAAAGCAGCAACCGCAATGCTCAGGGTTAAAACATTACAAAGGCGTCTGTCACAGGAACAG
TACAGTATTATCAAAATATTACATTTCAAACTTAGCAGATAATCACCAGAGCTCAACTCTTTAAATTATT
TCCATAGTCTTAAAAAAAATACACACACACACACATACACACGTCAGAAAGCAATATGAAAAAAAGTAGA
GAGGAAAACTTAAAAGCACAAAGAGAAAGACGCAACAAATAAATATCTGATTTAGTTACCTGTTAATAAT
CAACACCAATGTCCCCTTTGAACCCACCGGATGTTTTACCTATCATAATAATGAGCTCAAAGGCCACTGC
ATAATTATTTTTAAGTTATTATCAACGATTAGGACTAAAAAATAATTTGGCATCAAAATAATCAAAAGTC
GGCATAAAAAAAAAAAAGAA
Notes:The probe template was PCR amplified from IMAGE:1532092 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1532092 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17006 same embryo
 EMAGE:17008 same embryo
 EMAGE:17007 same embryo
 EurExpress:euxassay_008837 same experiment
 MGI:4828094 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS