Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17070

Sergef secretion regulating guanine nucleotide exchange factor ( MGI:1351630)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070
"Pseudo-wholemount" of euxassay_001466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001466_01 euxassay_001466_02 euxassay_001466_03 euxassay_001466_04
EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070
euxassay_001466_05 euxassay_001466_06 euxassay_001466_07 euxassay_001466_08 euxassay_001466_09
EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070
euxassay_001466_10 euxassay_001466_11 euxassay_001466_12 euxassay_001466_13 euxassay_001466_14
EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070 EMAGE:17070
euxassay_001466_15 euxassay_001466_16 euxassay_001466_17 euxassay_001466_18 euxassay_001466_19
EMAGE:17070
euxassay_001466_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17070Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17070_wholemount_strong.wlz
17070_wholemount_moderate.wlz
17070_wholemount_weak.wlz
17070_wholemount_possible.wlz
17070_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17070_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
spinal cord
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12
esophagus
moderate moderate
regionalmoderate expression: see section 12
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2919
Entity Detected:Sergef, secretion regulating guanine nucleotide exchange factor ( MGI:1351630)
Sequence:sense strand is shown

>T2919
TGGCCTCGAGCCAGATTCGGCACGAGGCTGAGAGAGAAGGTTGTTTGTGTCGCTGCTGGACTGAGGCATG
CCTTAGCCACTACAGCGACTGGCAGTGTGTTCCAGTGGGGGACTGGCTTGGCATCTTCTGGTCGACGCCT
GTGCCCTGGGCAGAATCTCCCACTGTTTTTGACAGCAAAGGAACCCAGCAGAGTGACAGGCCTGGAGAAT
TCTACAGCAGTGTGTGCTGTTGCAGGATCTGACCACTCGGCCTCATTAACAGACACAGAGAACACTGAAT
CTCAGGGTGCCGTGGACAGAGACAGACTGGAAGGAGAGACGATCAGTGACCTCAACCCAGACAGGACGAG
AAATGGGGGTGGGGGGTGTGAGAGCGAGACCGTTCAATAAAGTGGCTTTATACCAACAGAAAAAAAAAAA
AAAA
Notes:The probe template was PCR amplified from IMAGE:1531453 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1531453 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17073 same embryo
 EMAGE:17075 same embryo
 EMAGE:17072 same embryo
 EMAGE:17074 same embryo
 EMAGE:17071 same embryo
 EurExpress:euxassay_001466 same experiment
 MGI:4827965 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS