Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17079

Dnajb6 DnaJ (Hsp40) homolog, subfamily B, member 6 ( MGI:1344381)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079
"Pseudo-wholemount" of euxassay_001462. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001462_01 euxassay_001462_02 euxassay_001462_03 euxassay_001462_04
EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079
euxassay_001462_05 euxassay_001462_06 euxassay_001462_07 euxassay_001462_08 euxassay_001462_09
EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079
euxassay_001462_10 euxassay_001462_11 euxassay_001462_12 euxassay_001462_13 euxassay_001462_14
EMAGE:17079 EMAGE:17079 EMAGE:17079 EMAGE:17079
euxassay_001462_15 euxassay_001462_16 euxassay_001462_17 euxassay_001462_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17079Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17079_wholemount_strong.wlz
17079_wholemount_moderate.wlz
17079_wholemount_weak.wlz
17079_wholemount_possible.wlz
17079_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17079_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 04 05 13
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 13 14 15 16
spinal cord
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 08 11 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 12
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2940
Entity Detected:Dnajb6, DnaJ (Hsp40) homolog, subfamily B, member 6 ( MGI:1344381)
Sequence:sense strand is shown

>T2940
TGGCCTCGAGCCAGATTCGGCACGAGGCGGCACGAGGCCGGAACCCAGATGATGTCTTCAGGGAATTTTT
TGGTGGAAGGGACCCATTTTCATTTGACTTCTTTGAAGACCCATTTGATGACTTTTTTGGAAACCGAAGG
GGTCCCCGAGGAAATAGAAGCCGAGGTGCCGGCTCATTTTTCTCTACCTTCAGTGGATTTCCTTCTTTTG
GAAGTGGATTTCCTGCTTTTGATACAGGCTTCACTCCATTTGGGTCACTAGGTCATGGGGGTCTCACTTC
ATTTTCTTCAACGTCATTTGGCGGCAGTGGAATGGGCAACTTCAAATCAATATCAACTTCAACTAAGATA
GTTAATGGCAAAAAAATCACGACAAAGAGGATTGTGGAGAACGGTCAAGAAAGAGTAGAAGTTGAAGAAG
ATGGGCAGTTAAAGTCCTTGACAATAAATGGTAAGGAGCACCTGCTACGCTTGGATAACAAGTAACTCAA
CGCACGCATTTAACAGAAATGTTAAACCATAACAAGCACCATTTGAGGAATAACAGGAACTTTTTTTTTG
Notes:The probe template was PCR amplified from IMAGE:1531903 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1531903 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17077 same embryo
 EMAGE:17076 same embryo
 EMAGE:17078 same embryo
 EurExpress:euxassay_001462 same experiment
 MGI:4824348 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS