Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17730

Kbtbd11 kelch repeat and BTB (POZ) domain containing 11 ( MGI:1922151)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730
"Pseudo-wholemount" of euxassay_008912. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008912_01 euxassay_008912_02 euxassay_008912_03 euxassay_008912_04
EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730
euxassay_008912_05 euxassay_008912_06 euxassay_008912_07 euxassay_008912_08 euxassay_008912_09
EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730
euxassay_008912_10 euxassay_008912_11 euxassay_008912_12 euxassay_008912_13 euxassay_008912_14
EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730 EMAGE:17730
euxassay_008912_15 euxassay_008912_16 euxassay_008912_17 euxassay_008912_18 euxassay_008912_19
EMAGE:17730
euxassay_008912_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17730Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17730_wholemount_strong.wlz
17730_wholemount_moderate.wlz
17730_wholemount_weak.wlz
17730_wholemount_possible.wlz
17730_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17730_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 08 09 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 09 19
spinal cord
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 11 17
cervical ganglion
strong strong
regionalstrong expression: see section 10 18
thoracic ganglion
strong strong
regionalstrong expression: see section 16 moderate expression: see section 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 16 17 18 19
retina
strong strong
regionalstrong expression: see section 01 02 03
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35395
Entity Detected:Kbtbd11, kelch repeat and BTB (POZ) domain containing 11 ( MGI:1922151)
Sequence:sense strand is shown

>T35395
GGAGTGGCACTATTAGGAGGTGTGGCCTTATTGGAATGGGTAGTCACTGTGGGCATGGTCTTAAGACCCT
CATCCCAGCTGCCTGGAAGCCAGTCTTCTAGCAGCCTCTAGGTGAAGATGTAGAACTCTCAGCTCCTCCT
GCACCGTGCCTGCCTGGATGCTGCCATGCACCCACATTGATGACAAAGCACTGAGCCTCTGAACCTGTAA
GCCAGCCCCAGTTAAATGTGGTCCTTATAAGACTTGCCTTGGCCATGGTGTCTGCTCACAACAGTGAAGC
CCTAACTAAGACACTGCTGCTCAGCTCAGCTCCCTGTCTCCATTTCCAGGACCCAGTCAGGAAATGCTGC
TACCATAGCGAGCAGCTCTTTCCCTTCTAATTAATGTAATCAAGGCAACTCCTCACAGGCATGCTCAGAG
ACCTATGTTAACACCCACCTTTGCCCCCACAACAAGTGGGAGTGAATTTGTTAAGGTGTTAGTTTGGTAG
TGAGGGGAGTGAGCTTTGCCGAGATGTGGCTCCAGTGTGTGAACCAGGTAGGTGCTTCCTACACATGGGT
CCCATTCTGCCTCTTAACTCCACCTAGGAGTTTGGTTGGCATGAGCACAGATCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81183. Forward Primer - name:081183_F_cDNA_4930465M17Rik, sequence:GGAGTGGCACTATTAGGAGGTG; Reverse Primer - name:081183_N_SP6_cDNA_4930465M17Rik, sequence:AGATCTGTGCTCATGCCAACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17731 same embryo
 EMAGE:17734 same embryo
 EMAGE:17732 same embryo
 EMAGE:17733 same embryo
 EurExpress:euxassay_008912 same experiment
 MGI:4825692 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS