Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17767

Isl2 insulin related protein 2 (islet 2) ( MGI:109156)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767
"Pseudo-wholemount" of euxassay_008929. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008929_01 euxassay_008929_02 euxassay_008929_03 euxassay_008929_04
EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767
euxassay_008929_05 euxassay_008929_06 euxassay_008929_07 euxassay_008929_08 euxassay_008929_09
EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767
euxassay_008929_10 euxassay_008929_11 euxassay_008929_12 euxassay_008929_13 euxassay_008929_14
EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767
euxassay_008929_15 euxassay_008929_16 euxassay_008929_17 euxassay_008929_18 euxassay_008929_19
EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767 EMAGE:17767
euxassay_008929_20 euxassay_008929_21 euxassay_008929_22 euxassay_008929_23 euxassay_008929_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17767Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17767_wholemount_strong.wlz
17767_wholemount_moderate.wlz
17767_wholemount_weak.wlz
17767_wholemount_possible.wlz
17767_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17767_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 14 15 16 17 18
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 03 17 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 15 16 17 18 19
spinal cord floor plate
strong strong
regionalstrong expression: see section 10 11 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35472
Entity Detected:Isl2, insulin related protein 2 (islet 2) ( MGI:109156)
Sequence:sense strand is shown

>T35472
TGAGAGACGGGAAAACCTACTGCAAGCGGGACTACGTCAGGCTGTTCGGCATCAAGTGTGCCCAGTGCCA
GGTGGGCTTCAGCAGCAGTGACCTGGTGATGCGGGCGCGGGACAGCGTGTACCACATCGAGTGCTTCCGC
TGCTCCGTGTGCAGCCGCCAGCTGCTCCCTGGAGACGAGTTCTCGCTGCGGGAGCATGAGCTGCTCTGCC
GAGCTGACCACGGCCTCCTGCTGGAGCGCGCTGCGGCTGGCAGCCCGCGCACCCCCGGCCCGCTCCCCGG
CGCCCGCGGCCTGCATCTGCCAGACGCTGGGTCCGGACGACAGCCCTCACTGCGCACGCACGTCGACAAG
CAGGCGGAGAAGACAACCCGGGTACGGACTGTGCTCAACGAGAAGCAACTGCATACCCTGCGGACGTGCT
ACGCCGCCAATCCGCGGCCAGACGCGCTCATGAAAGAGCAGCTAGTAGAGATGACCGGCTTGAGCCCGCG
GGTCATCCGCGTGTGGTTTCAGAACAAGCGTTGCAAGGACAAGAAGAAGTCCATTCTCATGAAGCAGCTA
CAGCAGCAGCAACACAGTGACAAGGCGAGCTTCCAGGGACTGACTGGGACGCCTCTGGTGGCAGGCAGCC
CCATCGGCCATGAGAACGCGGTGCAGGGCAGCGCAGTCGAGGTGCAGACGTACCAGCCGCCCTGGAAAGC
ACTCAGCGAGTTTGCACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91356. Forward Primer - name:091356_F_cDNA_Isl2, sequence:TGAGAGACGGGAAAACCTACTG; Reverse Primer - name:091356_N_SP6_cDNA_Isl2, sequence:AGTGCAAACTCGCTGAGTGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17769 same embryo
 EMAGE:17768 same embryo
 EMAGE:17770 same embryo
 EMAGE:17771 same embryo
 EurExpress:euxassay_008929 same experiment
 MGI:4825630 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS