Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17796

Trank1 tetratricopeptide repeat and ankyrin repeat containing 1 ( MGI:1341834)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796
"Pseudo-wholemount" of euxassay_008939. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008939_01 euxassay_008939_02 euxassay_008939_03 euxassay_008939_04
EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796
euxassay_008939_05 euxassay_008939_06 euxassay_008939_07 euxassay_008939_08 euxassay_008939_09
EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796
euxassay_008939_10 euxassay_008939_11 euxassay_008939_12 euxassay_008939_13 euxassay_008939_14
EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796 EMAGE:17796
euxassay_008939_15 euxassay_008939_16 euxassay_008939_17 euxassay_008939_18 euxassay_008939_19
EMAGE:17796 EMAGE:17796 EMAGE:17796
euxassay_008939_20 euxassay_008939_21 euxassay_008939_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17796Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17796_wholemount_strong.wlz
17796_wholemount_moderate.wlz
17796_wholemount_weak.wlz
17796_wholemount_possible.wlz
17796_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17796_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 15 16 17
diencephalon
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
olfactory cortex
strong strong
regionalstrong expression: see section 11 12 15 16 17 18
hindbrain
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
midbrain
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14
spinal cord
strong strong
regionalstrong expression: see section 05 07 08 09 10 11
frenulum
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
seminiferous cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35480
Entity Detected:Trank1, tetratricopeptide repeat and ankyrin repeat containing 1 ( MGI:1341834)
Sequence:sense strand is shown

>T35480
GTGATTGACCTCAACCCTAAGCCCCTAGAGCCCATCATCCTCATTGGACGGAGCGGCACTGGAAAAACAA
CCTGTTGCTTGTACAGGCTTTGGAAGAAATTCCATGTTTACTGGGAGAAGGCTGAGCAGGCAGGAAGCCC
ATTGCTGTCCAAACAGATCTTGCCAAAGAGAAGGTTGGAAGTAGAACCAGGAAAAGAGGGTCCAGGTCGA
GAGGAAGAAGAACATGAGGAAGAGGAGGGTTCCATCAAAGTGGAAACGGTGGATGGTATAGATGAGGAGC
AAGAGAGTGAAGCCTGTGCAGGAGGAGCCACAGTGGAGCCAGCAGGGGACAGCCAAGGAGCAGAGGGATG
TGTGCCGGACCACCCACACCAGCTGGAGCATCTACATCAGATCTTTGTGACGAAGAACCATGTCCTGTGC
CAGGAGGTGCAAAGAAATTTTATTGAGCTCTCCAAGTCCACCAAGGCCACCAGTCACTATAAACCACTGG
ATCCCAATGTCCACAAACTCCAGGACCTGAGGGATGAAAACTTCCCTCTGTTTGTGACTTCTAAACAGCT
TCTCCTCCTGCTCGATGCCTCTCTGCCAAAACCTTTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82391. Forward Primer - name:082391_F_cDNA_Lba1, sequence:GTGATTGACCTCAACCCTAAGC; Reverse Primer - name:082391_N_SP6_cDNA_Lba1, sequence:AAAAAGGTTTTGGCAGAGAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17795 same embryo
 EMAGE:17793 same embryo
 EMAGE:17792 same embryo
 EMAGE:17794 same embryo
 EMAGE:17797 same embryo
 EurExpress:euxassay_008939 same experiment
 MGI:4828893 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS