Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17932

Dock10 dedicator of cytokinesis 10 ( MGI:2146320)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932
"Pseudo-wholemount" of euxassay_011695. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011695_01 euxassay_011695_02 euxassay_011695_03 euxassay_011695_04
EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932
euxassay_011695_05 euxassay_011695_06 euxassay_011695_07 euxassay_011695_08 euxassay_011695_09
EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932
euxassay_011695_10 euxassay_011695_11 euxassay_011695_12 euxassay_011695_13 euxassay_011695_14
EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932
euxassay_011695_15 euxassay_011695_16 euxassay_011695_17 euxassay_011695_18 euxassay_011695_19
EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932 EMAGE:17932
euxassay_011695_20 euxassay_011695_21 euxassay_011695_22 euxassay_011695_23 euxassay_011695_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17932Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17932_wholemount_strong.wlz
17932_wholemount_moderate.wlz
17932_wholemount_weak.wlz
17932_wholemount_possible.wlz
17932_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17932_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 07 08 15 16
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
thyroid gland
weak weak
regionalweak expression: see section 09 10 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 14 15 weak expression: see section 07
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 06 07
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37682
Entity Detected:Dock10, dedicator of cytokinesis 10 ( MGI:2146320)
Sequence:sense strand is shown

>T37682
ATTACTAACAACTCCAGGCGGAGGAAGCATGTTCTCTATGGGATGGCCAGCCTTTCTGAGCATCACCCCA
AACATTAAAGAAGAAGGAGCAATGAAAGAGGATTCTGGAATGCAAGACACCCCGTACAATGAGAACATCC
TAGTGGAACAGCTGTATATGTGTGTGGAGTTCCTTTGGAAGTCTGAACGATACGAACTCATCGCTGATGT
CAATAAGCCCATCATCGCTGTCTTTGAAAAGCAACGAGACTTCAAAAAATTATCAGATCTCTATTATGAC
ATCCACCGGTCCTATCTGAAAGTGGCAGAGGTGGTGAATTCGGAGAAGCGATTGTTTGGTCGTTACTATA
GAGTGGCGTTTTATGGGCAGGGATTCTTTGAGGAGGAGGAAGGTAAAGAGTATATCTACAAAGAGCCTAA
GCTGACAGGGCTCTCGGAGATCTCCCAAAGGCTTCTCAAGCTCTATGCAGACAAATTTGGAGCAGACAAT
GTGAAAATAATTCAAGATTCCAACAAGGTAAACCCCAAGGATCTGGACCCCAAATATGCCTATATTCAGG
TGACCTATGTCACACCATTCTTTGAAGAAAAGGAAATCGAGGACCGAAAGACAGACTTTGAAATGCATCA
CAACATCAATCGCTTTGTCTTTGAGACACCCTTCACTCTGTCAGGCAAGAAGCACGGAGGAGTGGCTGAG
CAGTGCAAGCGGAGGACAGTCCTGACCACAAGCCACTTGTTCCCCTACGTAAAGAAGAGGATCCAGGTCA
TCAGCCAATCAAGCACAGAGCTGAATCCTATCGAGGTGGCAATTGATGAGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75762. Forward Primer - name:075762_F_cDNA_Dock10, sequence:ATTACTAACAACTCCAGGCGGA; Reverse Primer - name:075762_N_SP6_cDNA_Dock10, sequence:CATCTCATCAATTGCCACCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17934 same embryo
 EMAGE:17933 same embryo
 EMAGE:17936 same embryo
 EMAGE:17935 same embryo
 EurExpress:euxassay_011695 same experiment
 MGI:4824369 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS