Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17966

Fam59a family with sequence similarity 59, member A ( MGI:2685790)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966
"Pseudo-wholemount" of euxassay_011729. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011729_01 euxassay_011729_02 euxassay_011729_03 euxassay_011729_04
EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966
euxassay_011729_05 euxassay_011729_06 euxassay_011729_07 euxassay_011729_08 euxassay_011729_09
EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966
euxassay_011729_10 euxassay_011729_11 euxassay_011729_12 euxassay_011729_13 euxassay_011729_14
EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966
euxassay_011729_15 euxassay_011729_16 euxassay_011729_17 euxassay_011729_18 euxassay_011729_19
EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966 EMAGE:17966
euxassay_011729_20 euxassay_011729_21 euxassay_011729_22 euxassay_011729_23 euxassay_011729_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17966Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17966_wholemount_strong.wlz
17966_wholemount_moderate.wlz
17966_wholemount_weak.wlz
17966_wholemount_possible.wlz
17966_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17966_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
brain
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 15 16
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
spinal cord
moderate moderate
spottedmoderate expression: see section 09
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 12
heart valve
strong strong
spottedstrong expression: see section 13
heart ventricle
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 14 15 16
tongue muscle
moderate moderate
spottedmoderate expression: see section 11 12 13 14 15 16
metanephros
moderate moderate
spottedmoderate expression: see section 06 07 08 09 17 18 19
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37725
Entity Detected:Fam59a, family with sequence similarity 59, member A ( MGI:2685790)
Sequence:sense strand is shown

>T37725
CCCATGATATCCTTCCCTATCAAGACTCTGGTGACAGTGGGAGCGACTACCTTTTCCCGGAAGCTAATGA
GGAGTCAGCGGGCATCCCGGGGAAAACAGAAGTTCCCTATGAAGAGCTGTGGCTGGAGGAAGGCAAGCCC
AGCCGCCAGCCTCTCACTCGCTCACTCAGTGAGAAGAGCAGGTGCGACACCTTGAGAGGCTCCACGAGGT
CCACGTGTGCACCCTCTTCTCCTCCCACCCCTGCGACCCTGGGAGCCACAATTAAGTCTTCAGAAATCGC
CCTACCTCCACCTCCAGTGCCTCCCAAATCTGAAGCTGTCAGGGAAGAATGCCGGCTCCTGAACGCCCCA
CCTGTGCCGCCCCGAAGTGCAAAGCCTTTGTCCACAAGTCCCTCCATCCCTCCTCGAACAGTCAAGCCAG
TCCGGCCACAGACGAGATCTCCAAGCCCCACCCTGTCTTACTATTCTTCAGGACTGCATAACATCATCAC
TCAGAGTGATACAAGTCCTCCCAACAGTGCCCCTGTGTCCTGCTACCCCTGCACCCGAGTGAAGAGTGAC
TCTGTGGACCCCAAGTCCCCATTTGGAAGTCCTTCCGCTGAAGCTCTGTCCTCCCGGCTCTCATGGCCCA
ACCATTACTCAGGAGCATCGGAGAACCAGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85701. Forward Primer - name:085701_F_cDNA_Gm944, sequence:CCCATGATATCCTTCCCTATCA; Reverse Primer - name:085701_N_SP6_cDNA_Gm944, sequence:GTCTGGTTCTCCGATGCTCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17965 same embryo
 EMAGE:17967 same embryo
 EMAGE:17968 same embryo
 EurExpress:euxassay_011729 same experiment
 MGI:4824749 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS