Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18277

Inpp4b inositol polyphosphate-4-phosphatase, type II ( MGI:2158925)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277
"Pseudo-wholemount" of euxassay_012070. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012070_01 euxassay_012070_02 euxassay_012070_03 euxassay_012070_04
EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277
euxassay_012070_05 euxassay_012070_06 euxassay_012070_07 euxassay_012070_08 euxassay_012070_09
EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277
euxassay_012070_10 euxassay_012070_11 euxassay_012070_12 euxassay_012070_13 euxassay_012070_14
EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277
euxassay_012070_15 euxassay_012070_16 euxassay_012070_17 euxassay_012070_18 euxassay_012070_19
EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277 EMAGE:18277
euxassay_012070_20 euxassay_012070_21 euxassay_012070_22 euxassay_012070_23 euxassay_012070_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18277Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18277_wholemount_strong.wlz
18277_wholemount_moderate.wlz
18277_wholemount_weak.wlz
18277_wholemount_possible.wlz
18277_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18277_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 14 15
telencephalon mantle layer
weak weak
regionalweak expression: see section 06 07 08 19 20 21 22
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 07 14 15 16
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 06 07 15 16
pons mantle layer
weak weak
regionalweak expression: see section 06 07 15 16
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30699
Entity Detected:Inpp4b, inositol polyphosphate-4-phosphatase, type II ( MGI:2158925)
Sequence:sense strand is shown

>T30699
ACACAGCGAAGGCAAAGGAAGTTCTCAGCAGCATCAATCAGCTACAACCTCTCATAGCAACTCATGCAGA
CCTGCTGCTAACCTCTGCCAGCCAGCGTTCTCCAGACAGCCTGAAGAGCTCTTTAAAGCTGCTTTCAGAA
AAAACTGAGCTTTTTGTCCATGCCTTCAAGGACCAGCTGGTCAGGAGTGCTCTTTTAGCTCTCTACACTG
CAAGGCCAGGAGGCATCCTTAAGAAGCCACCCTCTCCTAATGTCAGCACAGAGGAGAAAAGTACTCAGCA
TGATACCCCACAGCTTAGAAGACAAGACTCCATACCACATCATTCTGACTATGATGAAGAAGAGTGGGAT
AGGGTGTGGGCCAACGTGGGGAAGAGCCTGAACTGCATTATCGCTAAAGTAGACAAACTGATCGAGAGAG
ACAGTCACAACGAAGAAGGTGCTGGAGGCAGCAGTAGCAAGGATGGAGAGGCAGACCATACCCTGGAAGA
TTCCATCACATCTCACCCACGTGAGGACTGGTATGAACAGCTGCACCCACTCATCCTTACCTTGAAGGAG
TGCATGGGAGAAGTGGTGAACCGAGCAAAGCAATCCCTGACATTTGTACTGCTTCAGGAACTGGCCTACA
GTCTGCCCCAGTGTTTGATGCTGACTCTGAGAAGAGACATTGTCTTCAGTCAGGCGCTTGCTGGATTGGT
TTGTGGTTTTATCATCAAATTACATACAAGTTTGCATGACCCTGGCTTCCTACAGCAGCTTCATACAGTG
GGCTTGATAGTACAATACGAAGGACTGCTAAGTACTTACAGTGATGAAATTGGAATGCTGGAGGACATGG
CAGTCGGCATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6826283), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59814. Forward Primer - name:059814_F_IRAV118_f08_Inpp4b, sequence:ACACAGCGAAGGCAAAGG; Reverse Primer - name:059814_R_SP6_IRAV118_f08_Inpp4b, sequence:AAATGCCGACTGCCATGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18278 same embryo
 EMAGE:18275 same embryo
 EMAGE:18276 same embryo
 EMAGE:18279 same embryo
 EurExpress:euxassay_012070 same experiment
 MGI:4825594 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS