Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18298

2310057M21Rik RIKEN cDNA 2310057M21 gene ( MGI:1915527)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298
"Pseudo-wholemount" of euxassay_012086. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012086_01 euxassay_012086_02 euxassay_012086_03 euxassay_012086_04
EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298
euxassay_012086_05 euxassay_012086_06 euxassay_012086_07 euxassay_012086_08 euxassay_012086_09
EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298
euxassay_012086_10 euxassay_012086_11 euxassay_012086_12 euxassay_012086_13 euxassay_012086_14
EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298
euxassay_012086_15 euxassay_012086_16 euxassay_012086_17 euxassay_012086_18 euxassay_012086_19
EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298 EMAGE:18298
euxassay_012086_20 euxassay_012086_21 euxassay_012086_22 euxassay_012086_23 euxassay_012086_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18298Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18298_wholemount_strong.wlz
18298_wholemount_moderate.wlz
18298_wholemount_weak.wlz
18298_wholemount_possible.wlz
18298_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18298_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 09 10 11 12 16 17 18 19 moderate expression: see section 01 03 04 05 06 07 08 20 21 weak expression: see section 22 23 24
radius
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 moderate expression: see section 22 23 24
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 05
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 05
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 05
tarsus
strong strong
regionalstrong expression: see section 04
fibula
strong strong
regionalstrong expression: see section 02
tibia
strong strong
regionalstrong expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 20 21 moderate expression: see section 08 18 19 22 23 24
otic capsule
strong strong
regionalstrong expression: see section 10 16 moderate expression: see section 07 08 09 weak expression: see section 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
meckel's cartilage
strong strong
regionalstrong expression: see section 04 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 03 05 12
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
basioccipital bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 moderate expression: see section 08
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 16
exoccipital bone
strong strong
regionalstrong expression: see section 02 03 06 19 20 21 moderate expression: see section 01 04 05 07 23 24
temporal bone
strong strong
regionalstrong expression: see section 02 03 06 20 21 22 moderate expression: see section 01 04 05 07 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 06 18 19 20 moderate expression: see section 01 04 05 07 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
scapula
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 22 23 24
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 16 moderate expression: see section 09 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T107
Entity Detected:2310057M21Rik, RIKEN cDNA 2310057M21 gene ( MGI:1915527)
Sequence:sense strand is shown

>T107
AGAATGGAGACCGCGATCGAAGACGCGGGACTGGACCGCGGCCCGACGCTGACCTCGTCCTGGGATGCGG
CGTGCGGGGCGCTGACCCAAAGCCTTTTTCTTACCCGGACTGGGCCACGTGCCCAAGACTTGGACTTCGA
GCAGCTACTGGAGCCGCCAGCTCCGAGCCAGGATCCGGTTAGTCTGAAAAGCAGCCTGAGCCCCCGAGAT
GAAAACCCCTGCTTCATTTACCTGAACTGTGGCCCTAATGGGGGTGAAGAAATCCTTTCGGTTGGCGTTC
TGAGTTCAGCAAGAAACATGGAAGTATACTTAGGAGAGGAGTATTGTGGAACCAGTCGAGGCAAGACTGC
CTGCACTGTCCTGGATGACAGTGAACATGAAAAGATCTTGTTATACAAAAAATACCTAAAATTGGATTCT
CCCACGCATGCCTGTAAAATAAAGCTGTTGTCCTTCGGGGAGAAGCAGTGTGTGCTTGTCAGTAAGGTGG
TGGTGCACTTGA
Notes:The probe template was PCR amplified from IMAGE:569956 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:569956 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18296 same embryo
 EMAGE:18297 same embryo
 EMAGE:18294 same embryo
 EMAGE:18293 same embryo
 EMAGE:18295 same embryo
 EurExpress:euxassay_012086 same experiment
 MGI:4822668 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS