Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18356

Fam174b family with sequence similarity 174, member B ( MGI:3698178)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356
"Pseudo-wholemount" of euxassay_014291. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014291_01 euxassay_014291_02 euxassay_014291_03 euxassay_014291_04
EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356
euxassay_014291_05 euxassay_014291_06 euxassay_014291_07 euxassay_014291_08 euxassay_014291_09
EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356
euxassay_014291_10 euxassay_014291_11 euxassay_014291_12 euxassay_014291_13 euxassay_014291_14
EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356
euxassay_014291_15 euxassay_014291_16 euxassay_014291_17 euxassay_014291_18 euxassay_014291_19
EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356 EMAGE:18356
euxassay_014291_20 euxassay_014291_21 euxassay_014291_22 euxassay_014291_23 euxassay_014291_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18356Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18356_wholemount_strong.wlz
18356_wholemount_moderate.wlz
18356_wholemount_weak.wlz
18356_wholemount_possible.wlz
18356_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18356_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 10 14 15 20 21 22
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23 24 weak expression: see section 20
tibia
moderate moderate
regionalmoderate expression: see section 01 23 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 21 22 weak expression: see section 17 18 19 20
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 09 13 14 15 16 weak expression: see section 08 10 11 12 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 weak expression: see section 07 08 13 14 15 16
basioccipital bone
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 11 13 14 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 02 03 04 19 20 21 22 23
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 01 02 03 04 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 01 02 16 17 18 19 22 23 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31476
Entity Detected:Fam174b, family with sequence similarity 174, member B ( MGI:3698178)
Sequence:sense strand is shown

>T31476
GGCTTGTCAGCGTCCTGTGGGGAAGCTGGTCAGCTGCAGCCTGGGCTGTCAAGGTCTGGGCACCGTCTCT
CACCTGAGGTGATAAGACCCAAACCAATGTTATTTATGGAACTCTGGCTTCACCCTCCATGTCCAGCGTC
TGCCTGGAATGTCACTGTCACGCTCGTTCTCAGCTGCCAGAAAAAAGAGTCACCTTAGCCGGCCCTCGGA
TGACCCTTTGAAATTCTCTTTCCACCCTTGTCTTGAGGGGTTTTCTGCCTTCCTAAGAGATGAAGATGGG
AACATCGATTTCAAAGAATTTTCTAAAACAACTGTAGATAATAGTAAAGTCACAATTGGGAGATCAAGAG
TTTTAAAAAGCTGGGCTGGGGAGATAGCTTATGGGGTGACAACCTGATCACCTCACAAGCGGGGGGCATG
AGTTTGGTCCCTAGTGCTCACATTAAAGCAAAACTAGTCTGGTAGCCCACAACTGGAATCTTAGCACGAG
AGGCGGCTAGATCCTTGGGGTTGACTGTCCAGCCAGCCTAGCCTAATGAGCGGGTTCCAATGAAGACACC
TGGTCACAGAAAAGTGGGTTGGCTCCAGAGGCATAATAGCCAAGCTTCATTTCTGCCTCTATATATGTGT
ATGTTTGCCAACACACACACACACACACACCCCTCAGGACCTTCAGATATACCTGGGAGAATCCTGACAT
TTTTGTTCTCCCAAATCATTTCAGCTTCTTCAGGTCTGGCTTTATTTAGGGAAAAATTGTATATTTCAGG
ATGGATGTATACGTTTCCCATCCGATCTACCCTGTCTAAGAGGTTCCCCACAATAGGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4217593), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 26493. Forward Primer - name:026493_F_IRAV59-62_P17_A830073O21Rik, sequence:GGCTTGTCAGCGTCCTGT; Reverse Primer - name:026493_R_SP6_IRAV59-62_P17_A830073O21Rik, sequence:GGGCCTATTGTGGGGAAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18354 same embryo
 EMAGE:18353 same embryo
 EMAGE:18355 same embryo
 EMAGE:18352 same embryo
 EurExpress:euxassay_014291 same experiment
 MGI:4824722 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS