Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18416

Apitd1 apoptosis-inducing, TAF9-like domain 1 ( MGI:1917178)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416
"Pseudo-wholemount" of euxassay_014366. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014366_01 euxassay_014366_02 euxassay_014366_03 euxassay_014366_04
EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416
euxassay_014366_05 euxassay_014366_06 euxassay_014366_07 euxassay_014366_08 euxassay_014366_09
EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416
euxassay_014366_10 euxassay_014366_11 euxassay_014366_12 euxassay_014366_13 euxassay_014366_14
EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416
euxassay_014366_15 euxassay_014366_16 euxassay_014366_17 euxassay_014366_18 euxassay_014366_19
EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416 EMAGE:18416
euxassay_014366_20 euxassay_014366_21 euxassay_014366_22 euxassay_014366_23 euxassay_014366_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18416Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18416_wholemount_strong.wlz
18416_wholemount_moderate.wlz
18416_wholemount_weak.wlz
18416_wholemount_possible.wlz
18416_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18416_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23 24
radius
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 24 weak expression: see section 20
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 03
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 02 03
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 05 moderate expression: see section 23
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 05 moderate expression: see section 23
fibula
strong strong
regionalstrong expression: see section 03
tibia
strong strong
regionalstrong expression: see section 02 03 04 24
femur
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 20 21 22 24 moderate expression: see section 23
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 15 17 moderate expression: see section 16
nasal septum
strong strong
regionalstrong expression: see section 13 weak expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21 22 23
vault of skull
strong strong
regionalstrong expression: see section 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 06 07 08 09 weak expression: see section 15 16 19
scapula
strong strong
regionalstrong expression: see section 02 03 04 05 21 22 23
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31847
Entity Detected:Apitd1, apoptosis-inducing, TAF9-like domain 1 ( MGI:1917178)
Sequence:sense strand is shown

>T31847
GGAGTTCTCTCACCGGCAGAGGCTGAAGGCGGCAGTTCACTACACGGTCGGCTGTCTCTGCCAGGAAGTC
ACGCTGAACAAACAGGTGAACTTCAGCAAACAGACCATCGCGGCGATCTCCGAGGTGACTTTTCGGCAGT
GCGAAAATTTTGCCAAAGACCTTGAAATGTTTGCCAGGTGGGTAGAGAAGCTGGCAGTGTGATCTGAGGT
CCACTGACATCATTGTCCACATCTGTTGGTGTATTTCGGGGTTCTTGTTTTCTGGGGGTGGGGGTTGTGG
CTGATCATGACGCCGCTGGGGATTAACATCTGCTCTGAACACGTCAGTTCAGACCGCCTCGGTATTTCTG
AGTTTTCTTGCGGGTCTCCGAGTGACCCAGCTCTGGCTGACAGAGGTCTGAGTTGCATCCCCAGGACTCT
GCACTTGTGTGGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6741262), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 63464. Forward Primer - name:063464_F_IRAW2_b02_2610040C18Rik, sequence:GGAGTTCTCTCACCGGCA; Reverse Primer - name:063464_R_SP6_IRAW2_b02_2610040C18Rik, sequence:GCAGCCACACAAGTGCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18414 same embryo
 EMAGE:18417 same embryo
 EMAGE:18415 same embryo
 EMAGE:18413 same embryo
 EurExpress:euxassay_014366 same experiment
 MGI:4823177 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS