Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18498

Pxt1 peroxisomal, testis specific 1 ( MGI:1916557)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498
"Pseudo-wholemount" of euxassay_014447. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014447_01 euxassay_014447_02 euxassay_014447_03 euxassay_014447_04
EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498
euxassay_014447_05 euxassay_014447_06 euxassay_014447_07 euxassay_014447_08 euxassay_014447_09
EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498
euxassay_014447_10 euxassay_014447_11 euxassay_014447_12 euxassay_014447_13 euxassay_014447_14
EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498
euxassay_014447_15 euxassay_014447_16 euxassay_014447_17 euxassay_014447_18 euxassay_014447_19
EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498 EMAGE:18498
euxassay_014447_20 euxassay_014447_21 euxassay_014447_22 euxassay_014447_23 euxassay_014447_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18498Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18498_wholemount_strong.wlz
18498_wholemount_moderate.wlz
18498_wholemount_weak.wlz
18498_wholemount_possible.wlz
18498_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18498_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 12 13 weak expression: see section 09 11
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 16
thyroid gland
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 12
brain
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 01 02 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 16
spinal cord
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 06 08 09 10 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 12 13 14 15 16 17 18 weak expression: see section 09
neural retina
weak weak
regionalweak expression: see section 01 02 03 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 11 12 14 15 16 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37964
Entity Detected:Pxt1, peroxisomal, testis specific 1 ( MGI:1916557)
Sequence:sense strand is shown

>T37964
CACCATGCAGCTTAGACACATTGGGGACAGTGTCAATCACAGGGTGATTCAGGAGCATCTTGCACAGGAA
GTCGGAGATGTGCTGGCTCCTTTTGTGGCGCTGGTGTTCGTGAGAGGCCAGGTGCTGCTGAGATTTTTCT
GGAACAACCATTTGCTGTAAAGGAAGGACAGACAGACAAGTCCCACACTCTGGAGTCAAGCTGCTGTGAC
CCAAACCCTCTCCAACTCTTCCTCCTCCTCCCACTGAGGAAGGTCTACCCTGGGTCATGCCCTTTGATCC
TGCATTTATCACCTGTATCTAGATCTTCATTAAGAACCAACTTCATTAAGAGACTTGTCTACCTGGGCCC
CAGATCCTCTGCTCTGTGCGGAGCTGAAAGGAGCCGGGTCTCCAGTACGCAGCCCTGAGCCCTGGCCCAG
CCACCTTCCCTTCCATTAGACACCACCACCTGTTCCTGGTCTATTTCCTGCTCTGACTGTGCCACGTGGG
TTTCCGCTCTTTCTCAGGCCTAAGGAAGCCCTCCTGCCCTGAGGTTCCCTCAGGCCTCGCCTGATCCCAT
CCCTCACCCTGCAGCCCCATCCCCTCCAGGGTGCCTCCTGCTTGCCCAGCAAGCTCAGCTTCTAGGGAGC
TGGAAACTGCGACAATTACATTACACCCGAGGCCCACCAAGACGACTCTGCCTTTTGAGTTTGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66987. Forward Primer - name:066987_F_cDNA_Pxt1, sequence:CACCATGCAGCTTAGACACATT; Reverse Primer - name:066987_N_SP6_cDNA_Pxt1, sequence:AACAAACTCAAAAGGCAGAGTCG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18499 same embryo
 EMAGE:18497 same embryo
 EMAGE:18495 same embryo
 EMAGE:18496 same embryo
 EMAGE:18494 same embryo
 EurExpress:euxassay_014447 same experiment
 MGI:4827549 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS