Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18687

Clcn1 chloride channel 1 ( MGI:88417)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687
"Pseudo-wholemount" of euxassay_016591. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016591_01 euxassay_016591_02 euxassay_016591_03 euxassay_016591_04
EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687
euxassay_016591_05 euxassay_016591_06 euxassay_016591_07 euxassay_016591_08 euxassay_016591_09
EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687
euxassay_016591_10 euxassay_016591_11 euxassay_016591_12 euxassay_016591_13 euxassay_016591_14
EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687
euxassay_016591_15 euxassay_016591_16 euxassay_016591_17 euxassay_016591_18 euxassay_016591_19
EMAGE:18687 EMAGE:18687 EMAGE:18687 EMAGE:18687
euxassay_016591_20 euxassay_016591_21 euxassay_016591_22 euxassay_016591_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18687Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18687_wholemount_strong.wlz
18687_wholemount_moderate.wlz
18687_wholemount_weak.wlz
18687_wholemount_possible.wlz
18687_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18687_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 06 13 14 15 16 21 22 23 weak expression: see section 17 19
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 15 16 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 21 weak expression: see section 17 18 19 20
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45057
Entity Detected:Clcn1, chloride channel 1 ( MGI:88417)
Sequence:sense strand is shown

>T45057
CTGGAAGAGAAGTCATGGTTCCTACCATGCCAGAGACTCCTGTCCCACCACCATCTCCAGAGGCCCCTTC
CTGCCTGGCCCCAGCCAGAGCGGAGGGTGAGCTGGAGGAACTGGAGATGGTGGGGAGCCTAGAGCCTGAG
GAGGAGCTGGCTGACATCTTGCATGGCCCCAGTCTGCGGTCCACTGATGAGGAAGATGAGGACGAGCTGA
TCCTGTGAACAACCCCCTCTATGCCTTCTTCTTAAAAACCACAGGGCCCATGTCAGAGAGTGGACGTGTA
TGTGATATGGAGAGGCCTCCACTTCATCTTCTTCCTACCACCACTGTGAAAGGTGATGGTGATAATCTTA
AGGAGAACTTGATCTTGGGCAGGGAAGAATTTGGGTCCATCAGACCTCCCCCCGCCACCCCCCATTTCCA
TGCTTAAAGGACTCTTGTGTTTTCCTGCTGTGCAGGTTCAGTCCCTATCACTCTAAAGCCCCACAGTTCC
CAGTGTTCAGTCACCATCCTGGCCCTGCCTGTTTATATTCAGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 168813. Forward Primer - name:168813_F_Clcn1, sequence:CTGGAAGAGAAGTCATGGTTCC; Reverse Primer - name:168813_R_SP6_Clcn1, sequence:AACTGAATATAAACAGGCAGGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18685 same embryo
 EMAGE:18684 same embryo
 EMAGE:18686 same embryo
 EMAGE:18682 same embryo
 EMAGE:18683 same embryo
 EurExpress:euxassay_016591 same experiment
 MGI:4823898 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS