Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18909

Tmem132c transmembrane protein 132C ( MGI:2443061)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909
"Pseudo-wholemount" of euxassay_014171. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014171_01 euxassay_014171_02 euxassay_014171_03 euxassay_014171_04
EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909
euxassay_014171_05 euxassay_014171_06 euxassay_014171_07 euxassay_014171_08 euxassay_014171_09
EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909
euxassay_014171_10 euxassay_014171_11 euxassay_014171_12 euxassay_014171_13 euxassay_014171_14
EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909
euxassay_014171_15 euxassay_014171_16 euxassay_014171_17 euxassay_014171_18 euxassay_014171_19
EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909 EMAGE:18909
euxassay_014171_20 euxassay_014171_21 euxassay_014171_22 euxassay_014171_23 euxassay_014171_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18909Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18909_wholemount_strong.wlz
18909_wholemount_moderate.wlz
18909_wholemount_weak.wlz
18909_wholemount_possible.wlz
18909_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18909_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
dermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa dermal component
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21 22
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 12 13 14 15 16 17 18 19 weak expression: see section 03
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 16 17 18
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 17 weak expression: see section 12 16 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 15
cochlea
moderate moderate
regionalmoderate expression: see section 08 16
utricle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 17 18 19
middle ear mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23 24
anterior naris
moderate moderate
regionalmoderate expression: see section 10 11 13 14
external naris
moderate moderate
regionalmoderate expression: see section 09 10
nasal cavity
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14
pharynx
moderate moderate
regionalmoderate expression: see section 13 14 15
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 15 16 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 14 15
upper jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 15 16 18 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 18
urethra of male
moderate moderate
regionalmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38701
Entity Detected:Tmem132c, transmembrane protein 132C ( MGI:2443061)
Sequence:sense strand is shown

>T38701
ACACTGCAGACAAGCTACCAAAAATATTTGTTAAAAAAAATATATAAAAAGACGAATAAAAAAAACACAC
AAATGACTGTCGGTTTATATTTCTAATAAAGGAACAAAATGTAAAAATAGGGCTTGCTAAAAGAAGGCCT
ACATTTTAATTCAGTCTTTATGCTTCTGAGGACAGTCCAGGTCTGTTAGCCTTCTGCCCAAGGAGAGGCA
CATCTGAACAATGGTCACCTCTTAGGAAGAATGAGAATTTTACATTGGATTCCATTATCTCTGTTTGCTT
CCATGTTTCTTTCTAAGGTCCTAAGCCTCCATTTGATTCAATGTCATGTTTATTTCTGAGGACCAAGTGG
TACATTTTCCTAAATGAAATGTAAATTATATTTCTATTCATTAGATAGCTTTTTCCCCCTCTTTTTAAGA
AGATCATCAACGAATCCAGTCTTTACGTTGTAACATTAACCTGTCTTTATATTATACATCTCTTGCTTTG
TTAATATTTTCTGGCTTGTTTGTAATTCTTTTTGTTTTTTTGTTTTGTTTTGTTTTAACAATATAGCAAG
TGTGCAGTTCCCCACATGGGGAGAGTGCACCCCACAATCTGTCATCAGCCGGGTCAGGCCAATGAGTGGA
ATAATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 159577. Forward Primer - name:159577_F_cDNA_Mm.235920, sequence:ACACTGCAGACAAGCTACCAAA; Reverse Primer - name:159577_N_SP6_cDNA_Mm.235920, sequence:CATTATTCCACTCATTGGCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18908 same embryo
 EMAGE:18905 same embryo
 EMAGE:18906 same embryo
 EMAGE:18907 same embryo
 EurExpress:euxassay_014171 same experiment
 MGI:4828772 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS