Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18947

Thsd7a thrombospondin, type I, domain containing 7A ( MGI:2685683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947
"Pseudo-wholemount" of euxassay_014254. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014254_01 euxassay_014254_02 euxassay_014254_03 euxassay_014254_04
EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947
euxassay_014254_05 euxassay_014254_06 euxassay_014254_07 euxassay_014254_08 euxassay_014254_09
EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947
euxassay_014254_10 euxassay_014254_11 euxassay_014254_12 euxassay_014254_13 euxassay_014254_14
EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947
euxassay_014254_15 euxassay_014254_16 euxassay_014254_17 euxassay_014254_18 euxassay_014254_19
EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947 EMAGE:18947
euxassay_014254_20 euxassay_014254_21 euxassay_014254_22 euxassay_014254_23 euxassay_014254_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18947Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18947_wholemount_strong.wlz
18947_wholemount_moderate.wlz
18947_wholemount_weak.wlz
18947_wholemount_possible.wlz
18947_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18947_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 03 04 22 23
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 03 04 22 23 weak expression: see section 21 24
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 04 22 23 weak expression: see section 05 06 21 24
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 04 22 23 weak expression: see section 05 06 21 24
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 15 16 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
not examined not examined
regionalnot examined expression: see section 05 06 07 08 09 10 11 12 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 05 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18
dorsal grey horn
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 moderate expression: see section 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39779
Entity Detected:Thsd7a, thrombospondin, type I, domain containing 7A ( MGI:2685683)
Sequence:sense strand is shown

>T39779
CACAAGGAATTGTACGACTGGAGGCTGGGAACCTGGGATCGGTGTCAGCCTGTGATTTCGAAAAGCCTCG
AGAAATCACGAGAATGCGTGAAGGGTGAGGAAGGCATCCAGGTGAGAGAGATAATGTGCATCCAAAAGGA
CAAGGACATTCCCGCAGAGGACATCATCTGCGAGTACTTTGAACCCAAGCCCCTCCTGGAACAGGCCTGC
CTCATCCCTTGCCAGAAAGACTGCATCGTGTCTGAGTTCTCACCCTGGTCTGAGTGTTCCAGGACCTGTG
GCAGTGGCCTGCAGCACCGCACGAGGCACGTGGTTGCACCGCCACAGTATGGAGGCTCTGGCTGTCCCAA
CCTCACTGAGTTTCAGGTGTGCCAGTCCAACCCCTGCGAGGAGGATGAGAGCTTGTACAGCTTGCAGGTG
GGGCCCTGGAGCGCATGCTCAGTCCCACACACAAGGCAAGCCAGGCAAGCCAGGCGTCGTGGCAAGAACA
AGGAGAGGGAGAAGGAGAGAGGAAAAGCAGTGAAGGACCCAGAGGCCCGTGAGCTCATCAAGAAGAAGAG
AAACAGAAACAGACAGAACAGACAGGAGAACAGATACTGGGACATCCAGATTGGCTATCAGACCCGGGAC
GTGACGTGCTTAAACAGGACTGGGAAATCTGCGGACCTCAGCTTTTGCCAGCAAGAGAGGCTGCCCATGA
CCTTCCAGTCCTGCGTGATCACCAAAGAGTGCCAGGTGTCTGAGTGGTTGGAATGGAGCCCATGTTCAAA
AACATGCCATGATGTCACATCCCCTACAGGCACTCGAGTAAGGACAAGGACTATCACACAGTTTCCGATT
GGAAGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163817. Forward Primer - name:163817_F_cDNA_mCG141518, sequence:CACAAGGAATTGTACGACTGGA; Reverse Primer - name:163817_N_SP6_cDNA_mCG141518, sequence:TCACTTCCAATCGGAAACTGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18950 same embryo
 EMAGE:18949 same embryo
 EMAGE:18946 same embryo
 EMAGE:18948 same embryo
 EurExpress:euxassay_014254 same experiment
 MGI:4828707 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS