Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19045

Ssu72 Ssu72 RNA polymerase II CTD phosphatase homolog (yeast) ( MGI:1916241)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045
"Pseudo-wholemount" of euxassay_015839. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015839_01 euxassay_015839_02 euxassay_015839_03 euxassay_015839_04
EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045
euxassay_015839_05 euxassay_015839_06 euxassay_015839_07 euxassay_015839_08 euxassay_015839_09
EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045
euxassay_015839_10 euxassay_015839_11 euxassay_015839_12 euxassay_015839_13 euxassay_015839_14
EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045 EMAGE:19045
euxassay_015839_15 euxassay_015839_16 euxassay_015839_17 euxassay_015839_18 euxassay_015839_19
EMAGE:19045 EMAGE:19045 EMAGE:19045
euxassay_015839_20 euxassay_015839_21 euxassay_015839_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19045Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19045_wholemount_strong.wlz
19045_wholemount_moderate.wlz
19045_wholemount_weak.wlz
19045_wholemount_possible.wlz
19045_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19045_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 17 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 17 18 19 20 weak expression: see section 03 04 05 06 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40506
Entity Detected:Ssu72, Ssu72 RNA polymerase II CTD phosphatase homolog (yeast) ( MGI:1916241)
Sequence:sense strand is shown

>T40506
GCTGACCCTTAGAGAAGCAGAGAGGTCATCTGGTGGGTGTGATGTGTGACTGGTGTCACTCTGATCCCCC
ACCCTGCAGGCTGTGTTTTAGGAGAAACAGGACCTGCAAATGTGTTCTGGCGTATAGGCCAGTGGTGCCT
ACGTCAGTCCTTTTTTATTTATAAGAAGTCAGTTTTTCAGTTTCCTCCTTTTTTTTCTTCCTTTTTCTTT
TCTTTTCTTTCTTTCTTTTGTAAGTTTGAGATAGAGCCTCACTATGTGACCCTGGCTAGCCTGAGATTCA
CTCTGTAGACCAGGCTGACCTTGAACTCACAGACCCTCATGCCTCTGCCTCCTATGTGCTGGGACTACAG
ACATGGGACACTAGCCCAGTGGAGCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 158282. Forward Primer - name:158282_F_cDNA_Mm.5935, sequence:GCTGACCCTTAGAGAAGCAGAG; Reverse Primer - name:158282_N_SP6_cDNA_Mm.5935, sequence:ATGCTCCACTGGGCTAGTGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19046 same embryo
 EurExpress:euxassay_015839 same experiment
 MGI:4828462 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS