Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19208

Gfm2 G elongation factor, mitochondrial 2 ( MGI:2444783)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208
"Pseudo-wholemount" of euxassay_001861. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001861_01 euxassay_001861_02 euxassay_001861_03 euxassay_001861_04
EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208
euxassay_001861_05 euxassay_001861_06 euxassay_001861_07 euxassay_001861_08 euxassay_001861_09
EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208
euxassay_001861_10 euxassay_001861_11 euxassay_001861_12 euxassay_001861_13 euxassay_001861_14
EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208
euxassay_001861_15 euxassay_001861_16 euxassay_001861_17 euxassay_001861_18 euxassay_001861_19
EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208 EMAGE:19208
euxassay_001861_20 euxassay_001861_21 euxassay_001861_22 euxassay_001861_23 euxassay_001861_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19208Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19208_wholemount_strong.wlz
19208_wholemount_moderate.wlz
19208_wholemount_weak.wlz
19208_wholemount_possible.wlz
19208_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19208_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13
brain
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
spinal cord
weak weak
homogeneousweak expression: see section 07 08 09 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16
liver lobe
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1201
Entity Detected:Gfm2, G elongation factor, mitochondrial 2 ( MGI:2444783)
Sequence:sense strand is shown

>T1201
NCTGNTTGGCCTACTGGGGAACTGCTTAGAGGGCGGAAGAGAACGTTTTAGAGGACCACGATGTTCACCA
AATGGAGGATTTTTGCAGTGAATCATCAGAGAACGTTCAGTGTGCACCTTAATACCATGTGTTACTGCAA
AATAAAAGCAAATTTAAAAAGATTAAAGACTCAGCTGCCTCTTACAAGAAACTACAGTTCTGCACCAGGC
ATAGCAGGAAGTGATGTCAAGTCTCTTCATTCCGTCATTAACCCTCCTGTGGCCAAAATTCGTAATATTG
GAATTATGGCACATATTGATGCAGGCAAAACCACCACCACAGAGAGAATCCTGTACTATTCTGGATACAC
AAGATCATTGGGAGATGTCGATGATGGAGACACAGTGACGGATTTCATGGCTCAAGAGCGAGAAAGGGGC
ATTACCATCCAGTCAGCAGCTGTGACTCTCGACTGGAAAGGGTATAGAGTCAATCTGATTGATACTCCAG
GTCACGTAGACTTCACTCTGGAGGTCGAGCGCTGCTTGAGGGTG
Notes:The probe template was PCR amplified from IMAGE:2182416 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2182416 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19207 same embryo
 EMAGE:19205 same embryo
 EMAGE:19206 same embryo
 EurExpress:euxassay_001861 same experiment
 MGI:4825044 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS