Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19221

Tmem120a transmembrane protein 120A ( MGI:2686991)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221
"Pseudo-wholemount" of euxassay_009162. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009162_01 euxassay_009162_02 euxassay_009162_03 euxassay_009162_04
EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221
euxassay_009162_05 euxassay_009162_06 euxassay_009162_07 euxassay_009162_08 euxassay_009162_09
EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221
euxassay_009162_10 euxassay_009162_11 euxassay_009162_12 euxassay_009162_13 euxassay_009162_14
EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221
euxassay_009162_15 euxassay_009162_16 euxassay_009162_17 euxassay_009162_18 euxassay_009162_19
EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221 EMAGE:19221
euxassay_009162_20 euxassay_009162_21 euxassay_009162_22 euxassay_009162_23 euxassay_009162_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19221Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19221_wholemount_strong.wlz
19221_wholemount_moderate.wlz
19221_wholemount_weak.wlz
19221_wholemount_possible.wlz
19221_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19221_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 09 10 11 12 13 24 weak expression: see section 02 03 04 05 06 07 08 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 03 04 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 weak expression: see section 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09 10 11 12 13 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2399
Entity Detected:Tmem120a, transmembrane protein 120A ( MGI:2686991)
Sequence:sense strand is shown

>T2399
TGGCCTCGAGCAGATTCGGACGAGGGAGGCTTCTCCGGCCGGCCGGGGTTGCAGCTCCGTCCTCCCCACT
CGCGGCTCTCCGCGGCCAGTGGCGTGGACAAAGACATGCAGTCCCCGCCCCCGGACCCGCTGGGCGACTG
CCTGCGCAACTGGGAGGATCTGCAGCAGGACTTCCAAGGTATCCAGAAGAAGCGGCTCCAGGAGCTGGCC
TTGGTGCTGAAAAAATGCAGACCCTCTCTCCCATCCGAGTCCATGGAGGCTGCACAGGAGCTGGAAAACC
AGATGAAAGAGCGCCAAGGCCTCTTCTTCGACATGGAAGCCTATCTGCCTAAGAAGAACGGGTTGTACCT
GAGTCTGGTTCTGGGGAATGTCAACGTGACACTTCTGAGCAAGCAGGCTAAGTTCGCTTACAAAGACGAG
TACGAGAAATTCAAGCTCTACCTCACCATCATCCTCATCGTCATCTCCTTCACCTGCCGCTTCCTGCTCA
ACTCCAGGGTGACGGACGCAGCCTTCAACTTCCTGCTGGTCTGGTATTATTGCACGCTGACCATCC
Notes:The probe template was PCR amplified from IMAGE:1196000 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1196000 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19219 same embryo
 EMAGE:19220 same embryo
 EMAGE:19218 same embryo
 EMAGE:19217 same embryo
 EMAGE:19216 same embryo
 EMAGE:19214 same embryo
 EMAGE:19215 same embryo
 EurExpress:euxassay_009162 same experiment
 MGI:4828766 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS