Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19230

Paqr6 progestin and adipoQ receptor family member VI ( MGI:1916207)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230
"Pseudo-wholemount" of euxassay_001862. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001862_01 euxassay_001862_02 euxassay_001862_03 euxassay_001862_04
EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230
euxassay_001862_05 euxassay_001862_06 euxassay_001862_07 euxassay_001862_08 euxassay_001862_09
EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230
euxassay_001862_10 euxassay_001862_11 euxassay_001862_12 euxassay_001862_13 euxassay_001862_14
EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230
euxassay_001862_15 euxassay_001862_16 euxassay_001862_17 euxassay_001862_18 euxassay_001862_19
EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230 EMAGE:19230
euxassay_001862_20 euxassay_001862_21 euxassay_001862_22 euxassay_001862_23 euxassay_001862_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19230Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19230_wholemount_strong.wlz
19230_wholemount_moderate.wlz
19230_wholemount_weak.wlz
19230_wholemount_possible.wlz
19230_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19230_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 19 20 21 22
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 weak expression: see section 12 13 14 15 16
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
spinal cord ventricular layer
weak weak
regionalweak expression: see section 10 11
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 22 23
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 weak expression: see section 04 05
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13
lung
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 10 13 14 15 16 17 18 moderate expression: see section 11 12 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2530
Entity Detected:Paqr6, progestin and adipoQ receptor family member VI ( MGI:1916207)
Sequence:sense strand is shown

>T2530
TGGCCTCGAGNCAGATTCGGACGAGGCCTGGACCCTGCCCCCTGCTGCAGGGTAGCCCACTGGAAGAGGG
ACTCCAAGCTAAACAACAGTAAGGCCCATTGGCATGGAGGGAGGGAGAGGCCAGGTCTCACTGCCTCGGA
AGAGCCCTGCCTGACATGGGCCTGAGAAGGTGGCGACTATTCTGACCCTGAAAGGGGTAGCTGAAGAGAA
GAGGCTCTCTAGGGACAGGTGGAAGGACGGAAGACCCAAGAGGCAGGTGGTGAAGGTCTAAATTAACACA
GGTACCAGGCGGGGAGCAGAGTGGGGATGTGAGGCCTCTCCTGGGGCTTCTGCCCAGCTGCCCCAGGACC
TTGCTCACCTCAGGTCACCCTGAGATCTTGTTCCATCGGGGCCACATACCCACCCTGCCCCAGGGCCAGA
CTGTGCCTCTTGTCAGCAGCTCTGTATCTACTCACTGCTGCCTGTCTTGCTCACCACTGTGACCAAGCCT
TTGCCAATTTGTGTGTTTGGATGTGTCCCCGGTGAGATAATGGTTGTGGTGGGGATTG
Notes:The probe template was PCR amplified from IMAGE:1381988 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1381988 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19232 same embryo
 EMAGE:19231 same embryo
 EMAGE:19233 same embryo
 EurExpress:euxassay_001862 same experiment
 MGI:4827046 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS