Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19273

Rdh5 retinol dehydrogenase 5 ( MGI:1201412)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273
"Pseudo-wholemount" of euxassay_001873. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001873_01 euxassay_001873_02 euxassay_001873_03 euxassay_001873_04
EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273
euxassay_001873_05 euxassay_001873_06 euxassay_001873_07 euxassay_001873_08 euxassay_001873_09
EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273
euxassay_001873_10 euxassay_001873_11 euxassay_001873_12 euxassay_001873_13 euxassay_001873_14
EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273
euxassay_001873_15 euxassay_001873_16 euxassay_001873_17 euxassay_001873_18 euxassay_001873_19
EMAGE:19273 EMAGE:19273 EMAGE:19273 EMAGE:19273
euxassay_001873_20 euxassay_001873_21 euxassay_001873_22 euxassay_001873_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19273Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19273_wholemount_strong.wlz
19273_wholemount_moderate.wlz
19273_wholemount_weak.wlz
19273_wholemount_possible.wlz
19273_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19273_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16 17
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 08 12 13 14 15 moderate expression: see section 06 07
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 10 11 12 13 14 15 16 17
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 weak expression: see section 11 12
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1202
Entity Detected:Rdh5, retinol dehydrogenase 5 ( MGI:1201412)
Sequence:sense strand is shown

>T1202
CCTCGAGACTGTTGGCCTACTGGACACATTGTGTTGCCTGCCAGCTTTCCCCAGAGCCTAGGCTGCCCTC
AGCAGGGCATCTCATCCCATCATGTGGCTGCCTCTGCTTCTGGGTGCCTTGCTGTGGGCAGTGCTGTGGT
TGCTCAGAGACCGGCAGAGCCTGCCGGCCAGTGATGCTTTCATCTTCATCACTGGCTGTGACTCTGGCTT
TGGGCGCCTTCTGGCACTGCAACTTGACCAGAAGGGCTTCCAAGTCCTGGCCGGCTGCCTGACCCCCTCT
GGAGCAGAAGACCTGCAGCAGATGGCCTCCTCCCGCCTCCACACAACACTACTGGATATCACTGATCCCC
AGAATGTCCAGCAAGTTGCCAAGTGGGTGAAGACACGTGTTGGAGAAACTGGACTTTTTGGTCTGGTGAA
TAACGCTGGCGTAGCTGGTATCATCGGGCCCACACCATGGCTAACACAGGATGATTTCCAGAGAGTACTG
AGTGTGAACACACTGGGGCCCATCGGTGTCACCCTTGCCCTGCTGCCCCTGCTACAGCAGGCCAGGGGTC
GGGTGGTC
Notes:The probe template was PCR amplified from IMAGE:2182461 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2182461 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19271 same embryo
 EMAGE:19270 same embryo
 EMAGE:19269 same embryo
 EMAGE:19272 same embryo
 EurExpress:euxassay_001873 same experiment
 MGI:4827675 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS