Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19298

Stradb STE20-related kinase adaptor beta ( MGI:2144047)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298
"Pseudo-wholemount" of euxassay_009193. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009193_01 euxassay_009193_02 euxassay_009193_03 euxassay_009193_04
EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298
euxassay_009193_05 euxassay_009193_06 euxassay_009193_07 euxassay_009193_08 euxassay_009193_09
EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298
euxassay_009193_10 euxassay_009193_11 euxassay_009193_12 euxassay_009193_13 euxassay_009193_14
EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298
euxassay_009193_15 euxassay_009193_16 euxassay_009193_17 euxassay_009193_18 euxassay_009193_19
EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298 EMAGE:19298
euxassay_009193_20 euxassay_009193_21 euxassay_009193_22 euxassay_009193_23 euxassay_009193_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19298Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19298_wholemount_strong.wlz
19298_wholemount_moderate.wlz
19298_wholemount_weak.wlz
19298_wholemount_possible.wlz
19298_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19298_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 20 21 weak expression: see section 04
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13
neural retina
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 02 03 04 23
liver
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 23 weak expression: see section 01 02 03 04 10 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3529
Entity Detected:Stradb, STE20-related kinase adaptor beta ( MGI:2144047)
Sequence:sense strand is shown

>T3529
GCCTGCTTATAACAGGCCATCAGCGTCACTGCAGCCAGTGTCGCCGTGGAGCGAGCTGGAATTCCAGTTT
CCTGATGACAAAGACCCAGTGTGGGAATTCTAGGGTTGCCAAATCATTTCATGTCCTCTATACTTGACAG
CCTCTCCTTGCTGCTTGTCTTCGGTCCTGTTAGGTACAAATGACAAATCTATACTTGAAAATACAGTTGG
TGCACTGGAGAATCGATCAGTTAAACCACTCTGTTCATGGGGCGTGGATTTACCCTCTCTGCCCAGATCA
GAGCACCCGCACGACTTCCTCGTCAGTTACTGCCCAGCTCAGCTAGTGTCCGCTCGCCCGCCCTTCCGCA
CATCCCCCGCTTCTTTTCCACCTTTTAAGCTGTGACTGGTACTTTCTGGATCTCAGTGTAACTTTTGAGC
TAGTTAATTCTCTTCTACATTTTACTGTTCTCTGGGGAATGAACCCTTCCTCGGAGGACACTGCTTCCAG
AGCATCTTCTCTTCCAGATTCACTAGCCTTTTTGATCAGCTATTGG
Notes:The probe template was PCR amplified from IMAGE:3166461 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3166461 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19296 same embryo
 EMAGE:19295 same embryo
 EMAGE:19297 same embryo
 EurExpress:euxassay_009193 same experiment
 MGI:4828516 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS