Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19418

Crabp2 cellular retinoic acid binding protein II ( MGI:88491)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418
"Pseudo-wholemount" of euxassay_004796. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004796_01 euxassay_004796_02 euxassay_004796_03 euxassay_004796_04
EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418
euxassay_004796_05 euxassay_004796_06 euxassay_004796_07 euxassay_004796_08 euxassay_004796_09
EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418
euxassay_004796_10 euxassay_004796_11 euxassay_004796_12 euxassay_004796_13 euxassay_004796_14
EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418
euxassay_004796_15 euxassay_004796_16 euxassay_004796_17 euxassay_004796_18 euxassay_004796_19
EMAGE:19418 EMAGE:19418 EMAGE:19418 EMAGE:19418
euxassay_004796_20 euxassay_004796_21 euxassay_004796_22 euxassay_004796_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19418Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19418_wholemount_strong.wlz
19418_wholemount_moderate.wlz
19418_wholemount_weak.wlz
19418_wholemount_possible.wlz
19418_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19418_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 13 14 16 17 18 19 20 21
arm
moderate moderate
regionalmoderate expression: see section 22 23
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21
foot
moderate moderate
regionalmoderate expression: see section 02 03 04 05 16 17 18 19 20
leg
moderate moderate
regionalmoderate expression: see section 21 22 23
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 12
pituitary gland
moderate moderate
regionalmoderate expression: see section 10 11 12 13 weak expression: see section 09
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 05 06 17 18 19 moderate expression: see section 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 13 14 15 16 17 weak expression: see section 10 11 12
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 10 11 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 13 weak expression: see section 08 14 15
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 13 14 15 16 17 18 weak expression: see section 10 11 12
pons mantle layer
strong strong
regionalstrong expression: see section 08 15
midbrain meninges
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 weak expression: see section 07 08 09 10 11 12
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 14 15 16 17 moderate expression: see section 11 13 18 weak expression: see section 12
trigeminal v ganglion
strong strong
regionalstrong expression: see section 17 18 19 20 moderate expression: see section 03 04 05 06 07 08 14 15 16
ventral grey horn
strong strong
regionalstrong expression: see section 09 12 moderate expression: see section 10 11
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 08 09 13 weak expression: see section 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 07 08 09 10
saccule
moderate moderate
regionalmoderate expression: see section 05 06 07 08 14 15 16 17 18
cornea
moderate moderate
regionalmoderate expression: see section 02 03 20 21
retina
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 21 22
neural retina
moderate moderate
regionalmoderate expression: see section 23
anterior naris epithelium
strong strong
regionalstrong expression: see section 10 11 12 13
external naris epithelium
strong strong
regionalstrong expression: see section 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
vomeronasal organ epithelium
strong strong
regionalstrong expression: see section 12
lower lip
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 11 12
lower jaw molar
strong strong
regionalstrong expression: see section 06 14 15
upper lip
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 15
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 12
upper jaw molar
strong strong
regionalstrong expression: see section 06 15
metanephros
strong strong
regionalstrong expression: see section 05 06 07 17 moderate expression: see section 08 09 13 14 15 16
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 12
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6498
Entity Detected:Crabp2, cellular retinoic acid binding protein II ( MGI:88491)
Sequence:sense strand is shown

>T6498
GAAGGATCTGTTCTGCAAAGGAGACAGCAAAGTATCTTTAGCCTAAAGGACTCAGCGTCCAGTGTTCTAG
TTGAAGATCTAAAGAGAAAGCCACCTTGCTGTCACTATGCCTAACTTTTCTGGCAACTGGAAGATCATCC
GATCGGAAAACTTTGAGGAAATGCTAAAAGCTCTGGGGGTGAACATGATGATGAGGAAGATCGCTGTGGC
TGCAGCCTCCAAGCCAGCAGTCGAGATCAAACAGGAGAATGACACTTTCTACATCAAAACCTCCACCACT
GTGCGAACCACGGAGATTAACTTCAAGATCGGGGAGGAATTTGAGGAGCAGACCGTGGATGGGAGACCCT
GTAAGAGTTTGGTGAAATGGGAGAGTGGAAACAAAATGGTGTGCGAGCAGAGGCTTCTGAAGGGGGAGGG
CCCCAAGACCTCCTGGAGCCGAGAACTGACCAATGATGGAGAGCTGATCCTGACAATGACAGCAGATGAC
GTTGTGTGCACCAGGGTCTACGTCCGAGAGTGAGTGCCTACGGGTCCAAGAACTGCCTGAGACGACTTCT
GTGCCCGCTACAGGACACAAACCTCCCTCCCACGTCCATCTTACAAACTAGCTCTCCCCTTACTCCTGAG
GGTTACTGCTTCCTCCAAGGCCTTTTGTTCTTTGCCTTCTCTACGCCAGAGAGGGGCAGAAGCTCAGAAC
CCTCCCACCGCCATTTGCCCCTCCCAGGTCAGCAGTCCCAGCTCCATACCAGGGTCCTTCCTGGAAGAGA
CTGTCTCTCTGGCCTCTACTCCTTATCCTTGTAGTCTGTGTGATTTAGAATATTTATTGGTTAATTTTAT
TAAAATGTTTTAAAATGTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3588770 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3588770 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19413 same embryo
 EMAGE:19415 same embryo
 EMAGE:19416 same embryo
 EMAGE:19414 same embryo
 EMAGE:19417 same embryo
 EurExpress:euxassay_004796 same experiment
 MGI:4824040 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS