Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19746

Scarb1 scavenger receptor class B, member 1 ( MGI:893578)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746
"Pseudo-wholemount" of euxassay_006305. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006305_01 euxassay_006305_02 euxassay_006305_03 euxassay_006305_04
EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746
euxassay_006305_05 euxassay_006305_06 euxassay_006305_07 euxassay_006305_08 euxassay_006305_09
EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746
euxassay_006305_10 euxassay_006305_11 euxassay_006305_12 euxassay_006305_13 euxassay_006305_14
EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746 EMAGE:19746
euxassay_006305_15 euxassay_006305_16 euxassay_006305_17 euxassay_006305_18 euxassay_006305_19
EMAGE:19746 EMAGE:19746 EMAGE:19746
euxassay_006305_20 euxassay_006305_21 euxassay_006305_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19746Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19746_wholemount_strong.wlz
19746_wholemount_moderate.wlz
19746_wholemount_weak.wlz
19746_wholemount_possible.wlz
19746_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19746_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
regionalstrong expression: see section 02 03 04 05 11 12 13
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 08 15 16 17 weak expression: see section 07
adenohypophysis
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T704
Entity Detected:Scarb1, scavenger receptor class B, member 1 ( MGI:893578)
Sequence:sense strand is shown

>T704
TCCTCGAGNCTGTTGGCCTACTGGGCTGCTCCGGCCACCGCCAGGCACACACCTTGCTGCTGAGGGAGTC
TCGGCTTCTGTCATCTCTGTGGCCTCCGTCACCTCTGTCTCCGTCTCCTTCAGGTCCTGAGCCCCGAGAG
CCCCTTCCGCGCACGCGGACATGGGCGGCAGCTCCAGGGCGCGCTGGGTGGCCTTGGGGTTGGGCGCCCT
GGGGCTGCTGTTTGCTGCGCTCGGCGTTGTCATGATCCTCATGGTGCCCTCCCTCATCAAGCAGCAGGTG
CTCAAGAATGTCCGCATAGACCCGAGCAGCCTGTCCTTCGGGATGTGGAAGGAGATCCCCGTCCCTTTCT
ACTTGTCTGTCTACTTCTTCGAAGTGGTCAACCCAAACGAGGTCCTCAACGGCCAGAAGCCAGTAGTCCG
GGAGCGTGGACCCTATGTCTACAGGGAGTTCAGACAAAAGGTCAACATCACCTTCAATGACAACGACACC
GTGTCCTTCGTGGAGAACCGCAGCCTCCATTTCCAGCCTGACAAGTCGCATGGCTCAGAGAGTGAC
Notes:The probe template was PCR amplified from IMAGE:1889350 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889350 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19745 same embryo
 EMAGE:19748 same embryo
 EMAGE:19747 same embryo
 EMAGE:19744 same embryo
 EurExpress:euxassay_006305 same experiment
 MGI:4827887 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS