Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19780

Maob monoamine oxidase B ( MGI:96916)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780
"Pseudo-wholemount" of euxassay_006252. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006252_01 euxassay_006252_02 euxassay_006252_03 euxassay_006252_04
EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780
euxassay_006252_05 euxassay_006252_06 euxassay_006252_07 euxassay_006252_08 euxassay_006252_09
EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780
euxassay_006252_10 euxassay_006252_11 euxassay_006252_12 euxassay_006252_13 euxassay_006252_14
EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780
euxassay_006252_15 euxassay_006252_16 euxassay_006252_17 euxassay_006252_18 euxassay_006252_19
EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780 EMAGE:19780
euxassay_006252_20 euxassay_006252_21 euxassay_006252_22 euxassay_006252_23 euxassay_006252_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19780Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19780_wholemount_strong.wlz
19780_wholemount_moderate.wlz
19780_wholemount_weak.wlz
19780_wholemount_possible.wlz
19780_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19780_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
dermis
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vagus x ganglion
weak weak
regionalweak expression: see section 07 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 11 12 13 15 16 17 18
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 14 15
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10
liver left lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
liver right lobe
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 14
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T735
Entity Detected:Maob, monoamine oxidase B ( MGI:96916)
Sequence:sense strand is shown

>T735
NTCCTCGAACCTGTTGGCCTACTGGAGTGTGAGGCCACANNAAGCAGCGCGGTCGCAGGCAGAGGTCCAG
ACGCAGTAGCAGCGGACGCAAGAGACCTGGAACCTAGCAAGCAGCATGAGCAACAAAAGCGATGTGATCG
TGGTGGGGGGCGGCATCTCAGGTATGGCGGCAGCCAAACTTCTGCATGATTGTGGCCTCAGTGTGGTGGT
TCTGGAAGCACGGGACCGTGTAGGAGGCAGGACTTACACAATTAGGAATAAAAACGTTAAATATGTGGAC
CTTGGAGGATCTTATGTTGGGCCAACCCAGAATCGTATCTTACGATTGGCCAAAGAGCTAGGATTGGAGA
CCTATAAAGTTAATGAAGTTGAGCGGCTGATACACTTTGTAAAGGGAAAATCATATGCCTTCAGGGGCCC
ATTTCCACCAGTATGGAATCCTATCACCTACCTAGATAATAACAACCTCTGGAGGACAATGGATGAGATG
GGCCAAGAGATTCCCAGTGATGCTCCATGGAAAGCACCCCTTGCTGAAGAGTGGGACTACATGACAATGA
AAGAATTGC
Notes:The probe template was PCR amplified from IMAGE:1890672 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890672 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19782 same embryo
 EMAGE:19783 same embryo
 EMAGE:19781 same embryo
 EMAGE:19779 same embryo
 EMAGE:19778 same embryo
 EurExpress:euxassay_006252 same experiment
 MGI:4826076 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS