Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19804

Dsp desmoplakin ( MGI:109611)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804
"Pseudo-wholemount" of euxassay_006313. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006313_01 euxassay_006313_02 euxassay_006313_03 euxassay_006313_04
EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804
euxassay_006313_05 euxassay_006313_06 euxassay_006313_07 euxassay_006313_08 euxassay_006313_09
EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804
euxassay_006313_10 euxassay_006313_11 euxassay_006313_12 euxassay_006313_13 euxassay_006313_14
EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804
euxassay_006313_15 euxassay_006313_16 euxassay_006313_17 euxassay_006313_18 euxassay_006313_19
EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804 EMAGE:19804
euxassay_006313_20 euxassay_006313_21 euxassay_006313_22 euxassay_006313_23 euxassay_006313_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19804Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19804_wholemount_strong.wlz
19804_wholemount_moderate.wlz
19804_wholemount_weak.wlz
19804_wholemount_possible.wlz
19804_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19804_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18 19 20 weak expression: see section 10
pancreas
weak weak
regionalweak expression: see section 07 08 09 13 14
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 19 20 21 22 23 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 16 17 18 19 20 21 22 23 24
conjunctival sac
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24
naris
strong strong
regionalstrong expression: see section 13 17 moderate expression: see section 12 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 15 16 17 18
naso-lacrimal duct
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23 24
heart atrium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
heart ventricle
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
pharynx epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
tongue epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
stomach
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 06
rectum
weak weak
regionalweak expression: see section 11 12
midgut
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 07 08 09 10 11 12 13 14 15
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 19
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 19
kidney calyx
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16 17
kidney pelvis
weak weak
regionalweak expression: see section 15 16
seminiferous cord
weak weak
regionalweak expression: see section 03 04 05 06 17 18
urethra of male
strong strong
regionalstrong expression: see section 11 12
lung
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
trachea epithelium
strong strong
regionalstrong expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35002
Entity Detected:Dsp, desmoplakin ( MGI:109611)
Sequence:sense strand is shown

>T35002
GATTCCTCCAAGCTGGTATTTGATGGGCTGAGGAAGAAGGTGACGGCAATGCAGCTCTATGAGTGCCAGC
TGATCGACAAGACGACGCTAGACAAGCTGTTGAAGGGGAAGAAGTCAGTGGAGGAGGTGGCCTCAGAGAT
CCAGCCTTTCCTGCGCGGCGCAGGCGCCATCGCCGGGGCTTCCGCTTCTCCCAAGGAAAAGTACTCTTTG
GTGGAGGCCAAGAGAAAGAAATTCATCACCCCAGAATCCACTGTCATGCTTCTGGAGGCCCAGGCAGCCA
CCGGTGGTATCATCGATCCCCATCGGAATGAGAAGCTCACTGTGGACAATGCCGTAGCCCGGGATCTCAT
CGACTTCGACGACCGCCAACAGATCTACACAGCGGAGAAAGCCATCACTGGTTTCGATGACCCGTTTTCG
GGCAAGACGGTCTCTGTTTCAGAAGCCATCAAGAAGAATTTGATCGACAGAGAAACCGGAATGCGCCTGC
TGGAAGCCCAGCTTGCTTCAGGGGGTGTAGTTGATCCAGTCAACAGTGTCTTCTTGCCAAAAGATGTCGC
CTTGGCCCGTGGGCTGATTGATAGAGATTTGTATCGCTCCTTGAACGATCCCCGAGATAGTCAGAAGAAC
TTCGTGGATCCAATCACCAAGAAGAAGGTCAGCTACATGCAGCTGAGAGAAAGGTGCAGAATCGAACCCC
ACACGGGTCTGCTCCTGCTGTCAGTACAGAAGAGAAGCATGTCCTTCCAGGGAATCAGACAACCCGTGAC
CGTCACCGAACTGGTTGATTCTGGCATATTGAGACCGTCCACTGTAAACGAACTGGAATCCGGTCAGATT
TCCTATGATGAGGTTGGGGAGAGAATCAAGGACTTCCTCCAGGGTTCAAGCTGCATAGCAGGCATATATA
ATGAGACCACTAAGCAGAAGCTGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50010. Forward Primer - name:050010_F_cDNA_Dsp, sequence:GATTCCTCCAAGCTGGTATTTG; Reverse Primer - name:050010_N_SP6_cDNA_Dsp, sequence:CCCAGCTTCTGCTTAGTGGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19801 same embryo
 EMAGE:19802 same embryo
 EMAGE:19805 same embryo
 EMAGE:19800 same embryo
 EMAGE:19803 same embryo
 EurExpress:euxassay_006313 same experiment
 MGI:4824402 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS