Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19945

Mup5 major urinary protein 5 ( MGI:104974)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945
"Pseudo-wholemount" of euxassay_009368. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009368_01 euxassay_009368_02 euxassay_009368_03 euxassay_009368_04
EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945
euxassay_009368_05 euxassay_009368_06 euxassay_009368_07 euxassay_009368_08 euxassay_009368_09
EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945
euxassay_009368_10 euxassay_009368_11 euxassay_009368_12 euxassay_009368_13 euxassay_009368_14
EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945 EMAGE:19945
euxassay_009368_15 euxassay_009368_16 euxassay_009368_17 euxassay_009368_18 euxassay_009368_19
EMAGE:19945 EMAGE:19945 EMAGE:19945
euxassay_009368_21 euxassay_009368_22 euxassay_009368_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19945Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19945_wholemount_strong.wlz
19945_wholemount_moderate.wlz
19945_wholemount_weak.wlz
19945_wholemount_possible.wlz
19945_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19945_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19 21 22 23
facial vii ganglion
weak weak
regionalweak expression: see section 19 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 09 17 18 19 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 17 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 17 18 19
trigeminal v nerve
weak weak
regionalweak expression: see section 17
spinal cord
weak weak
regionalweak expression: see section 09 10 11 12 13 14
cervical ganglion
weak weak
regionalweak expression: see section 17
dorsal root ganglion
weak weak
regionalweak expression: see section 15 16
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 14 16 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 12 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36653
Entity Detected:Mup5, major urinary protein 5 ( MGI:104974)
Sequence:sense strand is shown

>T36653
GCTACTGCTGTGTTTGGAACTGACACTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTGAGAGACAGAAC
TTTAATGTAGAAAAGATTAATGGAAAATGGTTTTCTATTCTCCTGGCCTCTGACAAAAGAGAAAAGATAG
AAGAACATGGCACCATGAGAGTTTTTGTGGAGCACATCGATGTCTTGGAGAATTCCTTAGCTTTTAAATT
CCATACTGTTATAGATGAAGAGTGCACTGAAATATATTTGGTTGCTGACAAAACAGAAAAAGCTGGTGAA
TATTCTGTGACATATGATGGATTCAATACATTTACTATACTTAAGACAGACTATGATAATTATATTATGT
TTCATCTCATTAACAAAAAGGATGAGGAAAACTTCCAGCTGATGGAGCTCTTTGGTCGAGAACCAGATTT
GAGTTCAGACATCAAGGAAAAGTTTGCAAAACTATGTGAGGAGCATGGAATCGTTAGAGAAAATATCATT
GACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGTTTGAGCCTCCAGTGTTGAGT
GGAGACTTCTCACCAGGACTCCAGCATCATCCCTTCCCTTCCATACAGCATGGGGTGACAAGTTCTGTGA
TCTGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98164. Forward Primer - name:098164_F_cDNA_Mup5, sequence:GCTACTGCTGTGTTTGGAACTG; Reverse Primer - name:098164_N_SP6_cDNA_Mup5, sequence:AGCAGATCACAGAACTTGTCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19943 same embryo
 EMAGE:19942 same embryo
 EMAGE:19944 same embryo
 EurExpress:euxassay_009368 same experiment
 MGI:4826513 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS