Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19957

Nckap1 NCK-associated protein 1 ( MGI:1355333)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957
"Pseudo-wholemount" of euxassay_009378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009378_01 euxassay_009378_02 euxassay_009378_03 euxassay_009378_04
EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957
euxassay_009378_05 euxassay_009378_06 euxassay_009378_07 euxassay_009378_08 euxassay_009378_09
EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957
euxassay_009378_10 euxassay_009378_11 euxassay_009378_12 euxassay_009378_13 euxassay_009378_14
EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957 EMAGE:19957
euxassay_009378_15 euxassay_009378_16 euxassay_009378_17 euxassay_009378_18 euxassay_009378_19
EMAGE:19957 EMAGE:19957
euxassay_009378_20 euxassay_009378_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19957Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19957_wholemount_strong.wlz
19957_wholemount_moderate.wlz
19957_wholemount_weak.wlz
19957_wholemount_possible.wlz
19957_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19957_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 16
thoracic ganglion
weak weak
regionalweak expression: see section 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 01 02 03
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08 09 10 11 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36667
Entity Detected:Nckap1, NCK-associated protein 1 ( MGI:1355333)
Sequence:sense strand is shown

>T36667
CAAGATACTCCATTGCCTTTCCTCTGCTCTGCACTCACTTCATGAGCTGCACACATGAACTGTGTCCTGA
AGAACGCCATCATATAGGAGATCGTAGCCTTTCCCTGTGCAATATGTTCCTGGATGAGATGGCCAAACAA
GCTCGAAATCTCATCACCGATATTTGCACAGAACAGTGTACTCTTAGTGACCAGTTATTGCCGAAGCATT
GTGCCAAAACCATCAGTCAAGCAGTGAATAAGAAGTCAAAAAAACAGACGGGCAAGAAAGGGGAACCTGA
AAGGGAAAAACCGGGTGTGGAGAGCATGAGGAAAAACAGGCTGGTAGTGACCAACCTTGATAAGTTGCAC
ACTGCACTTTCGGAGTTATGCTTCTCCATAAATTATGTTCCAAACATGGCGGTGTGGGAGCACACCTTCA
CGCCGAGGGAGTATTTGACTTCTCATCTGGAAATCCGGTTCACTAAATCAATTGTTGGAATGACTATGTA
TAATCAAGCTACACAGGAAATTGCAAAGCCATCAGAGCTTCTAACAAGCGTAAGGGCATATATGACTGTA
CTCCAGTCCATAGAGAACTATGTGCAGATTGATATCACCAGAGTATTTAATAATGTCCTTCTTCAGCAAA
CACAACACTTAGACAGCCATGGAGAACCAACCATCACGAGTCTGTATACAAACTGGTACTTGGAAACTTT
ATTAAGACAAGTCAGCAATGGCCATATAGCTTATTTTCCTGCAATGAAAGCATTTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90706. Forward Primer - name:090706_F_cDNA_Nckap1, sequence:CAAGATACTCCATTGCCTTTCC; Reverse Primer - name:090706_N_SP6_cDNA_Nckap1, sequence:CACAAATGCTTTCATTGCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19954 same embryo
 EMAGE:19953 same embryo
 EMAGE:19956 same embryo
 EMAGE:19952 same embryo
 EMAGE:19955 same embryo
 EurExpress:euxassay_009378 same experiment
 MGI:4826619 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS