Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20063

Tmem138 transmembrane protein 138 ( MGI:1920232)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063
"Pseudo-wholemount" of euxassay_012505. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012505_01 euxassay_012505_02 euxassay_012505_03 euxassay_012505_04
EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063
euxassay_012505_05 euxassay_012505_06 euxassay_012505_07 euxassay_012505_08 euxassay_012505_09
EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063
euxassay_012505_10 euxassay_012505_11 euxassay_012505_12 euxassay_012505_13 euxassay_012505_14
EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063 EMAGE:20063
euxassay_012505_15 euxassay_012505_16 euxassay_012505_17 euxassay_012505_18 euxassay_012505_19
EMAGE:20063 EMAGE:20063
euxassay_012505_20 euxassay_012505_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20063Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20063_wholemount_strong.wlz
20063_wholemount_moderate.wlz
20063_wholemount_weak.wlz
20063_wholemount_possible.wlz
20063_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20063_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 08 09 10 11 12 13 15
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 10 11 12
choroid invagination
weak weak
regionalweak expression: see section 05 06 07 14 15 16 17
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 12 14 15 18 19 20 21
medulla oblongata alar plate ventricular layer
weak weak
regionalweak expression: see section 04 05 06 08 09 10 11 12 13 14
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 04 05 06 08 09 10 11 12 13 14
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 04 05 06 08 09 10 11 12 13 14 16 17 18 19 20
pons ventricular layer
weak weak
regionalweak expression: see section 04 05 06 08 09 10 11 12 13 14 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 08 09 10 11 12 13 15 16
midbrain ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30407
Entity Detected:Tmem138, transmembrane protein 138 ( MGI:1920232)
Sequence:sense strand is shown

>T30407
CCAAGGAAACAGCTCCGATTTGGAAAAACTAAACATCTCTCCTGGAGTTCTGGGCAGAGAGAAAACCAGT
AGTCATTTTCTTCGGAACTGTGGAATGTACCCTTGGGAGTCCCACAAATCAGGCAGAAGATGCTCCAGAC
CGGTAACTACAGCCTGGTGCTCTCCCTGCAGTTCCTGTTGCTGTCCTATGACCTGTTCGTCAACTCCTTC
TCAGAGCTACTCCGAATGGCTCCTGTTATCCAGCTTGTGCTGTTCATCATCCAGGATATTGCAATCCTCT
TCAACATCATCATAATTTTCCTCATGTTCTTCAACACCTTCGTCTTCCAGGCTGGCCTGGTCAACCTCCT
TTTCCATAAGTTCAAAGGGACCATCATTCTGACATCTGTGTACCTTGCCCTCAGCATCTCCCTACATGTC
TGGGTCATGAACGTGCGATGGAAAAACTCCAGCAGCTTCAGCTGGACAAACGGCCTGCAAACACTGTTTG
TATTCCAGAGACTAGCCGCAGTGCTCTACTGCTATTTCTACAAAAGGACGGCCGTGAGACTGGGTGACCC
CCGCTTTTACCAGGACTCACTGTGGCTTCGCAAGGAGTTCATGCAAGTCCGAAGGTGACCACTTCATGTC
ACATGGGTGAATACCTTTCCTTCCTGGTAGAAGGCGCCTGCCTGGGCTGCTCTCCAGGGAGGAGCAGCCA
TTGGCACCAGGAAGCAGGGGGACTTCCTAGGACACATTTATGCTATCTGTGCTCAGCATTCAAGAAGGAA
GATTCACCAGGCATGGTTGGAAACAGAGGCAGGAGGATTGCTGTGGTTTGAGGCCACCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6307765), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60181. Forward Primer - name:060181_F_IRAV103_g07_2900055D14Rik, sequence:CCAAGGAAACAGCTCCGA; Reverse Primer - name:060181_R_SP6_IRAV103_g07_2900055D14Rik, sequence:TAGGGTGGCCTCAAACCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20062 same embryo
 EMAGE:20065 same embryo
 EMAGE:20064 same embryo
 EMAGE:20061 same embryo
 EMAGE:20060 same embryo
 EurExpress:euxassay_012505 same experiment
 MGI:4828775 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS