Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20084

Ahcyl2 S-adenosylhomocysteine hydrolase-like 2 ( MGI:1921590)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084
"Pseudo-wholemount" of euxassay_009089. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009089_01 euxassay_009089_02 euxassay_009089_03 euxassay_009089_04
EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084
euxassay_009089_05 euxassay_009089_06 euxassay_009089_07 euxassay_009089_08 euxassay_009089_09
EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084
euxassay_009089_10 euxassay_009089_11 euxassay_009089_12 euxassay_009089_13 euxassay_009089_14
EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084
euxassay_009089_15 euxassay_009089_16 euxassay_009089_17 euxassay_009089_18 euxassay_009089_19
EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084 EMAGE:20084
euxassay_009089_20 euxassay_009089_21 euxassay_009089_22 euxassay_009089_23 euxassay_009089_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20084Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20084_wholemount_strong.wlz
20084_wholemount_moderate.wlz
20084_wholemount_weak.wlz
20084_wholemount_possible.wlz
20084_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20084_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
regionalstrong expression: see section 09 10 11 17 moderate expression: see section 18 19
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 13 17 19 moderate expression: see section 06 11 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 07 08 09 10 13 14 15 16 17 19 moderate expression: see section 04 06 11 12 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 07 08 09 17 19 20 21 22 weak expression: see section 06 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17
naris
weak weak
regionalweak expression: see section 13
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
hindgut
moderate moderate
regionalmoderate expression: see section 14
rectum
moderate moderate
regionalmoderate expression: see section 14
midgut
moderate moderate
regionalmoderate expression: see section 10 13 14 15 16 17 weak expression: see section 12
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 19
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2412
Entity Detected:Ahcyl2, S-adenosylhomocysteine hydrolase-like 2 ( MGI:1921590)
Sequence:sense strand is shown

>T2412
TTGAATGAGTCCCTCTCATGGCCCTCCCTATTTAGAAGTCTCCTGTTTGTTCCCCATGTGTCTTTTACAT
TGATACATCTTTTACATTGTATCAAGAGCAAGGTCATTCCAACAGAGGACACCCAGAATCACTGAAACCT
TCCTCTAGATCTTCTCCCCTGGCTCCACCATCTCTGCTGTCCCTTGGTCTTTGTGTGTGCCCTGGAAGCT
AGTCTGGAAGTGTCCTTATTTTCTAAGATAGGGAAACAGAACTTGGGTAGGTGGCTGGTTTGCCTTATGG
TATACATTCTGGCTCACCCCAGAAGATGGACTCTTGCCAGGACAGCATCTGTGGCTGTATTCTGTTGTAT
AAGGAAGATCAGAAACACTGAAGACCTTACCGAGATAGGCCGTTCTGTTTGCCTCATTCTGATTTCTGTA
TTAGCGGAATGCATCAATCACTCTCCCACTACCATATCTGTTTTGTTTTTTGTTTTTTGTTTTTTTGTTA
TTGTTGTTGGGGTTGTTGTTGTTTTGAGATAGTCTTGCTCTGTA
Notes:The probe template was PCR amplified from IMAGE:1226225 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1226225 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20086 same embryo
 EMAGE:20085 same embryo
 EMAGE:20083 same embryo
 EurExpress:euxassay_009089 same experiment
 MGI:4823038 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS