Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20133

Ina internexin neuronal intermediate filament protein, alpha ( MGI:96568)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133
"Pseudo-wholemount" of euxassay_012424. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012424_01 euxassay_012424_02 euxassay_012424_03 euxassay_012424_04
EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133
euxassay_012424_05 euxassay_012424_06 euxassay_012424_07 euxassay_012424_08 euxassay_012424_09
EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133
euxassay_012424_10 euxassay_012424_11 euxassay_012424_12 euxassay_012424_13 euxassay_012424_14
EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133 EMAGE:20133
euxassay_012424_15 euxassay_012424_16 euxassay_012424_17 euxassay_012424_18 euxassay_012424_19
EMAGE:20133 EMAGE:20133
euxassay_012424_20 euxassay_012424_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20133Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20133_wholemount_strong.wlz
20133_wholemount_moderate.wlz
20133_wholemount_weak.wlz
20133_wholemount_possible.wlz
20133_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20133_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
strong strong
homogeneousstrong expression: see section 08 09 10 12 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
metencephalon rest of alar plate mantle layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 15
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 16
cervical ganglion
strong strong
regionalstrong expression: see section 09 16
thoracic ganglion
strong strong
regionalstrong expression: see section 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 14 15 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 20 21 moderate expression: see section 02
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 12 13 14 moderate expression: see section 15
vomeronasal organ
strong strong
regionalstrong expression: see section 10 12 13
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 13 moderate expression: see section 01 02
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 moderate expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31317
Entity Detected:Ina, internexin neuronal intermediate filament protein, alpha ( MGI:96568)
Sequence:sense strand is shown

>T31317
TTAAGCATCTCGGGGCTGAATCCACTGCCCAATCCCAGTTATTTGCTCCCTCCCAGAATCCTTAGCTCTA
CAGCCTCCAAAGTCTCCTCTGCCGGGCTGTCCCTGAAAAAGGAGGAAGAAGAGGAGGAGGAAGAGGCCTC
TAAGGAAGTCAGTAAGAAAACATCCAAGGTAGGGGAAGGTTTCGAAGAGACACTGGGGGAAGCGGTAATA
TCTACGAAGAAAACTGGAAAGTCGGCTACAGAAGAAAGTACCAGTTCAAGCCAAAAAATGTAATGCCGCT
GCTTGAGAAAAAGTCGATGCCTGGGAGGGAATGCACTTGGCTCATTCACGGCACACTCCTGAACCACACC
CACCACCGCTATAGAATGTCTGCAAGGCTTCAGCGTCATTGTACCGACCCCTTACGTTCTCCAGTAGGAA
GGCCACTGTAGACGGGCGCAAGCTGCAGTCCTGGAGCAGAGGAGGAGTTCTCCAAGAACACAGCTTTCTC
ACCCACAGTTCAGGCTTCCTGGTGACAGGTGACTCAGGTGCAGAGGAAGTGCAAATGAAGGTGCTAAATC
TGCTCATCCCTCACTGGGAGCTGAAACGGAAACCTATGTTTATCCACTGGACCCCGCCAGGCCCCAGCCA
TAGAACCTTACTGTAGATGCCTAAAAGCATACAATCACTGCAGAGGACAAGCTAGTGCTCCAGACACCGC
TCCCCAGCCCCCTCCGATAGAGCCGAGTCACCACACACGTCTCTCATGGGCACATGCCTTCCACTCTTCA
ATCCCATAATTCCTTTCTCGCACCCAAGAGGAAGGAACAGAGTTTAGTGTAGCATCCCCTTCTAGCCACG
CATAGAACGTATGCCCTTTAGCTAGCTCTTCTTCACTCTGTGGGTAAAATTAGCTGCATGCTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4502421), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 20110. Forward Primer - name:020110_F_IRAV51-54_G05_Ina, sequence:TTAAGCATCTCGGGGCTG; Reverse Primer - name:020110_R_SP6_IRAV51-54_G05_Ina, sequence:GGCCAGCATGCAGCTAAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20129 same embryo
 EMAGE:20132 same embryo
 EMAGE:20134 same embryo
 EMAGE:20131 same embryo
 EMAGE:20130 same embryo
 EurExpress:euxassay_012424 same experiment
 MGI:4825588 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS